Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1119
Length(NT) : 713
Best Gene Model Blast : Link to GSTUMT00008451001 E-value : 0.0
Numbers of ESTs : 2

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig1119
TTGGGTCGGGGACAACTTTGTACAAAAAAGTTGGAAACGGAATCCGCGAA
ATCTAAAGGGTATACAAATGGAGTCAACGGGCACAGTGTAAGGGCCTCCT
CGGTGGCGGAACATCTACCAAATTTACACAGTTCAAGCTCTTCGCCGTTG
CCAAAGTCTGAAACACCGATTAATATCAGCGACCAGCATCCGGCTGGAGA
CCGCCGCGAAGCATCCGTTCCCGCCCGTCCCGAGCAGCGTCAAGTCGAAG
AAGGAGAAGGAGAAGGGGGATAAGAAGGACAAGCCAGAGGGCTACCACAT
GGGCGGCATAAACAGGCTCAGGAGCACTAGCCGCAGCCTCCGCCTCAGCC
AAGCCTTGAGGCTAGGAGGCAAGGATAAGGATCGCACCAGCACGCATGAA
GAGAATGGCGCGATTCCAGATCTACCACCGTTTCCCGTCACACCCGGACC
CGGACCCGGACTTCCGGTGGGGGACCTGACCCCGAACGGGGTCAACCATG
AGAAGTCGGATGACGAGAAGAGTGGGGATGATTCCCCATCCGGGACCGAA
GTGCCGTCGGCTGTCGAGTCACCGAAGGTAACTGTTCCAGCGGTCGCACC
GGCAAAACTGGGGGAATCACCGGTGGAGCCAAAGGAGGAGGTAGTAGTCC
CCCAGGAGACGGAGAGGGGGGATAAGAAGGGGAACAGCAAGAAGAAGAAG
GGGAAGAAGGAGA

Sequences in the Contig:

SY0AAA42YF15FM1 SY0AAC24YG08FM1