Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1118
Length(NT) : 1105
Best Gene Model Blast : Link to GSTUMT00005275001 E-value : 0.0
Numbers of ESTs : 3

Blast Results:

Nr Definition: conserved hypothetical protein
Accession: ref|XP_001210520.1| Score: 1053 E_value: 1e-112
KEGG Definition: DUF255 domain protein; K06888
Accession: afm:AFUA_1G12370 Score: 1037 E_value: 1e-111
KOG Definition:
Classification: [General function prediction only].
Kog Number: KOG2244 Score: 811 E_value: 3e-87
PFAM Definition: No Hit Found
Swissprot: Q09214|YP65_CAEEL

Sequence:
>Contig1118
TGTACAAAAAGTTGGCCAACTTTTTTGTACAAAGTTGTCCCCTGTAAGTC
GAGTCGCACCGTTCAATCCGGATTACCCAGAGGGGCTGTATCTTCGCGGG
GAGTGGATCGTCTTATTAACTGCCTTCTTGCTTTCGTGTTAGGTTATGGA
ACGTGAGAGCTTTGAAAACGAAGAGATCGCTAGGATTTTGAACGAGAACT
TTATCCCCATAAAGATCGACAGAGAGGAGAGGCCGGATATCGACCGTATC
TATATGAACTTTGTACAAGCAACGACAGGATCAGGTGGTTGGCCGCTCAA
TGTCTTCCTCACCCCAGATCTCCAACCGGTGTTCGGTGGGACTTATTGGC
CAGGCCCAAGTGCGGTCGGCGGGATGAAAGATCAGCTTGGGTTTCTGGAA
GTGCTTAGGAAGATTGCAAACGTATGGAAGGAACAACACGAACGATGCGT
AGCATCTGCATCCGATATCCTGAACCAATTGAAAGAATTCACAGACGAAG
GGCTTAAAGGAACGGGGGGTGAGCCGGGCGATGGGTTAGAGTTGGACTTG
CTTGAGGAAGCCTACCAGCACTTTATGGCTCGCTATGACCCGCTGTATGG
TGGGTTTGGAAACGCGCCCAAGTTCCCTACTCCTGTTAACCTGGCCTTCT
TGTTGCGTCTGGGAACCTTCCCTGCGACTGTTCAAGATATTGTGGGCGAA
ATGGAATGTGAGAATGCAAAGTCGATGGTCATTGATACGCTTCAAGGCAT
GGCGAAAGGTGGAATACATGATCATATAGGCCACGGGTTTTCTCGGTACT
CAGTTACTGCAAATTGGAACTTGCCCCACTTTGAGAAAATGCTCTACGAC
CAGGCGCAGCTTCTCAGCATTTATATCGATGCTTGGCTGGTAACAAAGTC
GCCGGCAATGCTCGAGGCGGCGAATGATATCGCAGAGTATATGTGTTTGG
ATGCGTTAAAGAGCCCGGATGGTGCTTTCTATTCGTCAGAGGATGCGGAC
TCACTTTATAGAAAGGCGGATACTGAGAAACGAGAAGGGGCATTTTATGT
CTGGACAAGAAAAGAATTTGATGTTATGCTTGGAGAACAGGATGCGTCGA
TTTGC

Sequences in the Contig:

SY0AAA29YP12FM1 SY0AAA42YF12FM1 SY0AAC4YP12FM1