Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1117
Length(NT) : 927
Best Gene Model Blast : Link to GSTUMT00003351001 E-value : 0.0
Numbers of ESTs : 2

Blast Results:

Nr Definition: hypothetical protein FG07127.1
Accession: ref|XP_387303.1| Score: 904 E_value: 2e-95
KEGG Definition: hypothetical protein
Accession: fgr:FG07127.1 Score: 904 E_value: 8e-96
KOG Definition:
Classification: [Amino acid transport and metabolism].
Kog Number: KOG0564 Score: 813 E_value: 1e-87
PFAM Definition: No Hit Found
Swissprot: O74927|MTHR2_SCHPO
Gene Ontology:
GO:0004489 = Molecular function: methylenetetrahydrofolate reductase (NADPH) activity
GO:0006555 = Biological process: methionine metabolic process

Sequence:
>Contig1117
TTGGTGAGGGCCCGGATATGAACGGAGCGGCTCTGAGAAGGGATAGGAGA
ACTTCTTCCGTAACCTCAGATCCTCATAATCGTGTGATTGTTGATAACTC
CAGTTCTCTGCAATCGCCAAGGCTCGCAAATGCACTCGAAGCTGGCTTTC
TGAAACCACCCGAGCGGTCTCGCCCGCCAGAGGTAGCGTTGGCAATCTCC
GAAGGTGAGGGTGCTTTGGGGAGAGAGGCGACTTGGGACGACTATCCGAA
CGGCCGTTTTGGCGATGCGAGGTCTCCGGCCTTTGGTGAAATCGATGGTT
ATGGGCCGTCGCTTCACTTGTCGCAAGCCCAGGCAATCAAACTTTGGTCA
TACCCGGTTACTAAGCAGGACGTCTCCGACATCTTCGTCCAGCATATCAA
GGGTGAACTAGAGGCTATTCCCTGGAGTGAGCAAGGTCTGAGTGTGGAGA
GTAAGGTTATTGCGGACCATTTGGCTAAATTGAACCAGAAGGGATTCTGG
ACTGTGGCATCCCAGCCAGCGATCAACGGTGTTAATAGCACTGATGAAAC
CTTTGGCTGGGGGCCGAAGGGGGGTTTTGTATTCCAAAAGGCCTTTGTTG
AGTTTTTCTGCTCGACAGAGGATTGGGAAGTATTGAAGGCAAGGCTAGAG
AGAGTTGAGGATGTCTCCTACTATGCTGCAAACAAGGCTGGAGACTATGT
TGCAAGCGTGCCCCCCGGCGGCAGCGCCATGCACGCAGTTACGTGGGGTG
TCTTCCCGGGAAAGGAAATTATAACACCAACCATAATCGAAGAAGTTTCC
TTCAAAGCTTGGAAGGAAGAAGCTTTTAGTATCTGGAAAGAGTGGGCGAG
GGTGTACCCGCCCACATCTGCGTCGTCGAAGTTGTTGATGGAAACTGCGG
AGACGTACTACTTGGTTAATATTATTC

Sequences in the Contig:

SY0AAA42YE24FM1 SY0AAC45YE02FM1