Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1116
Length(NT) : 763
Best Gene Model Blast : Link to GSTUMT00010426001 E-value : 1e-173
Numbers of ESTs : 2

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition:
Classification: [Signal transduction mechanisms, Cytoskeleton].
Kog Number: KOG3671 Score: 437 E_value: 4e-44
PFAM Definition: Drf_FH1, Formin Homology Region 1. This region is found in some of the Diaphanous related formins (Drfs). It consists of low complexity repeats of around 12 residues..
Pfam Number: pfam06346 Score: 384 E_value: 5e-38

Sequence:
>Contig1116
TTGGCATCGCGACCCCGCCCCCGCAGCAATCCTTCAAGGTGCCTCCTCCA
TTACCAAACGCTGGAGTTTATGCCAATTCAGTTCCTCCAAGACATTCTCC
GGCTCCTCCTCCGCCAAGTGCTCCTCCGCTGCCCCCGAAGACACCGCTGG
AAGATTCACACCCATCTCCACCTAGGTTTGGTGTTCCACCCCCTCTCCAG
GCGTCTGTCAACCGCCCCCCACCAGCGCCCAGCAGAGGGCCACCTCCCAC
TTTACCTTCGAGAGTGCAGTATCCCGGCCCTCCTCCGCCTCCAAGACCAG
CTGTAGAACCACCGGCTCCGCCGGCGCGAGACATGCCACCACCCCCACCC
CTGCCGCCAGCTCCAGCCCCTCCGGTGCCCGGACTCCCAAGTGCCCCACC
TCCGCCTCCATCCCCTTCAGTGCCCGGCTTTAACGGAGCTCCGCCACCAC
CTCCCCCGCCAATGCCTGGCTTTGGTACATCTGCTCCACCTCCACCTCCA
CCCCTTCCAGGCTTTGGCGGGAGTGCGCCCCCAGCTCCACCACCTCCACC
ACCCCCAGGGTTTGGGGGAGGTGCGCCCCCACCACCGCCCCCACCGCTTC
CTGGAAGGACTGATAGTGCGCCGGGCGGGGCTGCTCCTCCGTTACCGGCG
GTGGAGGGTGGTAGAGGAGATCTGTTAGCTAGCATTCGTGGTGCGGGAGG
AATAAATGCTCTCAAGAAAACACCCAAAGGTCCTGCTGCTGGTGGCGCAC
TACCGCCGGCCTC

Sequences in the Contig:

SY0AAA42YE18FM1 SY0AAB57YG09FM1