Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1115
Length(NT) : 2762
Best Gene Model Blast : Link to GSTUMT00009612001 E-value : 0.0
Numbers of ESTs : 84

Blast Results:

Nr Definition: hypothetical protein An01g04980
Accession: ref|XP_001388924.1| Score: 190 E_value: 4e-12
KEGG Definition: hypothetical protein
Accession: ang:An01g04980 Score: 190 E_value: 2e-12
KOG Definition:
Classification: [Function unknown].
Kog Number: KOG0917 Score: 117 E_value: 2e-06
PFAM Definition: Atrophin-1, Atrophin-1 family. Atrophin-1 is the protein product of the dentatorubral-pallidoluysian atrophy (DRPLA) gene. DRPLA OMIM:125370 is a progressive neurodegenerative disorder. It is caused by the expansion of a CAG repeat in the DRPLA gene on chromosome 12p. This results in an extended polyglutamine region in atrophin-1, that is thought to confer toxicity to the protein, possibly through altering its interactions with other proteins. The expansion of a CAG repeat is also the underlying defect in six other neurodegenerative disorders, including Huntington's disease. One interaction of expanded polyglutamine repeats that is thought to be pathogenic is that with the short glutamine repeat in the transcriptional coactivator CREB binding protein, CBP. This interaction draws CBP away from its usual nuclear location to the expanded polyglutamine repeat protein aggregates that are characteristic of the polyglutamine neurodegenerative disorders. This interferes with CBP-mediated transcription and causes cytotoxicity..
Pfam Number: pfam03154 Score: 117 E_value: 2e-06
Swissprot: P34708|TRA1_CAEEL
Gene Ontology:
GO:0005737 = Cellular component: cytoplasm
GO:0005634 = Cellular component: nucleus
GO:0008022 = Molecular function: protein C-terminus binding
GO:0009792 = Biological process: embryonic development ending in birth or egg hatching
GO:0019099 = Biological process: female germ-line sex determination
GO:0019101 = Biological process: female somatic sex determination
GO:0040035 = Biological process: hermaphrodite genitalia development
GO:0002009 = Biological process: morphogenesis of an epithelium
GO:0043525 = Biological process: positive regulation of neuron apoptosis
GO:0007283 = Biological process: spermatogenesis
GO:0030104 = Biological process: water homeostasis

Sequence:
>Contig1115
TGTACAAAAAGTTGGCCAACTTTTTTGTACAAAGTTGGCAACACTTTCAA
AACCTCTACTCACCCTCTAGTCGCTCCTTTATTCCCCTCTTCTACGTCTA
ACTACCCTCCTCCTCCTTTTCACCTTTCCAAACATCAAAACATTTCAATC
CCCCGTCCTGGAAATTAGCCAATGATTGAATCAGGGTATCATCGACCACA
TACTCGTTTCAAAATGGCCACCCAGATGGGCATCGGAAAGTCATCCGCTC
GAGAGGCGGTGGGCCACGATGGCTACCCCAATTTCCCCGGTGAGCCTTAC
ATCGACAACGCGGAGACCACTGTCATCGAAAATGACCCACAGCGCCGGCT
CCCGCCCCCAAAAGTCCCGAAATCGCAACATGTCACTTCCCATATTCTCT
CAGGCCCCTCTGAATCTCACACCCCTTCTAGCCATTTGATGGATCCTCCT
TTCACTAGGCAGCTGATCCGTAATCTCTCCGTTTCCTCGAGGCTCCACGT
AGCGGGTTACTCGACCACATGTCCTTTAAAGTGCGCTCAATGTCAATGGT
CTCCAAACGAGGCTACATTGTTTGACAAGGTCCCTCGGGGCCACCGATAT
CACAGGGTTGATAAGTTATGCCTCGGCACTGAAGTCTTATCCTCTAATGG
TATCACTTTGTCCAATAATGACTCTTCGGGGGATTGTCGAAGTTGCAAGT
GTACTGTTGGGGATTCTAGTTTGAACAGAGAGTTTGGGACGCAGCCGTCG
GTCGCTGGAGGGCCATCCAAGGGGTGGGCTTCTGTAGTCGGGTTAAAAAC
AGGTGGATCGGGGGATGCAAATCGGTTCGCGTCATACATGCTTGTTATCT
GGCTCTTACCACTCGCGGTGTCCACTTTTCTCGTGGCGGCGTTGGGGATT
CCACACGGTGCTCGCGCCGGTGCTCTCCTCAACTCTACGGGAGAATTTGT
CGTTTCAAAACCACCTCCTAGGCTGAGAACTCCTGGTCAAATAAACGGAG
CAGCCTCCTATGAAGCTGGCGGCTTTGGCGATACACTGCAAACTCGAAGG
AAGCATTGTGGTTATTACCGCTGTTTCCCTCAGCTTTCCAACCCCCCTAT
ACATTGGAACAGCTACATCGATCTCGCCCCGCTTCACGCTTAAAAACTAT
CCTACGAGCTAATTGCTCTGAAACATTTTGTTATACCTATAACAACCGCC
GCGTTTTTTCTCTTCTTCTATCCCTCTAGAAGCGCCTCTCTGCCTGCTCC
TGTAGGCCAACTACGTCTATTAACTCCTACCCCCTGCTCCTGGCCCATCA
CAAACATGTCCGGATACGATCAATTCACACCCGGGGAGTATCTTCCTGTG
GGATACGACCCAGATAATTCGCATTTTGCGGACGCGATATACACATTGAT
CCCCGAGTACGAGGAACCGATCCTCGACTACACCGACCTACCCCAAACTC
CCACGGATGCCTCCCTCCATCCTATATTCATGTTCACGCCTCACATATCA
CCCTTAGAGACGCCACAAACATCTCCCGCGACGCTGTGCGGAGATCCCCA
GTGGCTGCCTAGGAGCGAATTTGGGGACGATTCCTCGGGAGACCTTTTCT
CTTTCGGGTCCCCTTCCTCAAATTTTCCTTCTTCCCCCGTGGAGACCCCG
AACTCATTCAAATCATCCCCCGGGGATCAGATCCCCCAAACTCCCATATC
TTTGGAGCCAAGCTCCCCACCACCCCACGCCCCGGAACCCCTCAAGAACC
CTGACGGCACATGGGCATTCCCCCAAGCCGGAACATCTCTGGAGCCAAGC
TCTCCACCACTCCCCGCCCCGGAGCCCGTTCAGAACCCTGACGGCACGTG
GGCATGCCCTCAAGCCGGATGTACCCACCCCGGCCACAAGCGGCGGTGCG
ATGCTAGAAAGCATCACAAATCCCACACCAAGCCGTATGCTTGCGAGATG
GGGAACTGCACCTACAGATCCTCAAACGCTAAAGATCGGGAGCGGCATTA
TGACACTCGGCACGCAAGCATGAAGCATCCCGCGTGTCCCGCACCAGGCT
GTGGGGTTCTCAAGAGTCGCGTCGACAACATGCGCGACCATATCCGCAGG
AAGCACCAGGGGATGGATTATAGGAGCCCGAAAATTTCGGCGCTTTACCC
GCGCCGCCGCGGCAGGAGATAGTTACTCCCCCCAAACTCTTTGGCTGATA
AGCCAGCAATTCTCATGCCCGGTGTTGGCATCTTTGTCCTCTAACTATGA
AGTAGGGGCGAATGGATAATTTCTTTCACGTGATTTATAGGCATCCTTCG
TTTCCGGGGGAGCCGGTTATTTCTGATTGGTGGACCCCGTTCACCCTTCA
CGGAACAATCGACTTCCCCAGATTCAATGGGTTTCAATGAACTACGTGGT
AGAGATTGTTTCTTCCAGTGCTGATCGGATGGGAAGGCTAGATCAGCTGG
GGGTAGTCCGAGGGTGGAAAGCCCGGCTTTCACTCTGTTTCCTTGGAGTG
GGTTCTCGCGTTGTTTTTTGGTTTTTTTTCTTTGGTTTTTGGTTTTGTTT
TATCTCCATTTACTCGCTTTTTTGTTTTTCAGGTTGTAAGGTTTCTCACG
GACCGGAGGTGGAAAAATGTGACGGTTTCATTTTATTGATTTTGATTTTT
TTGAAAATGGCGGGGAAAATAGGGCCTCTTGTGCGAACAATTGGCGGTTC
GGAAAAAAAATTGATGTTCTCGCATGTTTAGTTTTTGGAATTTAGAAAAT
TTGTTGCGCGTC

Sequences in the Contig:

SY0AAA11YB12FM1 SY0AAA11YE22FM1 SY0AAA12YO24FM1
SY0AAA13YG11FM1 SY0AAA13YM02FM1 SY0AAA16YD17FM1
SY0AAA17YH10FM1 SY0AAA22YF16FM1 SY0AAA22YF16RM1
SY0AAA27YM10FM1 SY0AAA27YO10FM1 SY0AAA28YP17FM1
SY0AAA2YB15FM1 SY0AAA33YK11FM1 SY0AAA33YL20FM1
SY0AAA35YC02FM1 SY0AAA36YH13FM1 SY0AAA37YF15FM1
SY0AAA37YN05FM1 SY0AAA38YC10FM1 SY0AAA39YL08FM1
SY0AAA3YG20FM1 SY0AAA3YP02FM1 SY0AAA40YA13FM1
SY0AAA40YK12FM1 SY0AAA41YC15FM1 SY0AAA41YM01FM1
SY0AAA42YE07FM1 SY0AAA42YH19FM1 SY0AAA44YN16FM1
SY0AAA46YC09FM1 SY0AAA46YL01FM1 SY0AAA46YO09FM1
SY0AAA47YL19FM1 SY0AAA47YN22FM1 SY0AAA49YJ23FM1
SY0AAA4YC23FM1 SY0AAA4YJ01FM1 SY0AAA52YK19FM1
SY0AAA53YG19FM1 SY0AAA55YG15FM1 SY0AAA57YL17FM1
SY0AAA58YL08FM1 SY0AAA61YI08FM1 SY0AAA61YM18FM1
SY0AAA7YM11FM1 SY0AAB21YC02FM1 SY0AAB25YM07FM1
SY0AAB28YK18FM1 SY0AAB28YP12FM1 SY0AAB29YA13FM1
SY0AAB2YC24FM1 SY0AAB2YG07FM1 SY0AAB31YH22FM1
SY0AAB33YB01FM1 SY0AAB35YF21FM1 SY0AAB35YO01FM1
SY0AAB38YP22FM1 SY0AAB40YC03FM1 SY0AAB41YB05FM1
SY0AAB42YC18FM1 SY0AAB42YH03FM1 SY0AAB43YC23FM1
SY0AAB43YP14FM1 SY0AAB48YC10FM1 SY0AAB48YH21FM1
SY0AAB50YO13FM1 SY0AAB51YH11FM1 SY0AAB53YC21FM1
SY0AAB54YA23FM1 SY0AAB55YK20FM1 SY0AAB56YH03FM1
SY0AAB58YF20FM1 SY0AAB5YE13FM1 SY0AAB60YE01FM1
SY0AAB60YI23FM1 SY0AAB8YP19FM1 SY0AAC18YA20FM1
SY0AAC40YL01FM1 SY0AAC41YE15FM1 SY0AAC4YF09FM1
SY0AAC57YK14FM1 SY0AAD35YP14FM1 SY0AAD36YE15FM1