Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1114
Length(NT) : 1697
Best Gene Model Blast : Link to GSTUMT00005413001 E-value : 0.0
Numbers of ESTs : 10

Blast Results:

Nr Definition: ADP-ribosylation factor 6
Accession: ref|XP_001246273.1| Score: 826 E_value: 4e-86
KEGG Definition: conserved hypothetical protein; K07941 ADP-ribosylation factor 6
Accession: mgr:MGG_10676 Score: 821 E_value: 8e-86
KOG Definition:
Classification: [Intracellular trafficking, secretion, and vesicular transport].
Kog Number: KOG0071 Score: 776 E_value: 5e-83
PFAM Definition: Arf, ADP-ribosylation factor family. Pfam combines a number of different Prosite families together.
Pfam Number: pfam00025 Score: 728 E_value: 2e-77
Swissprot: P26990|ARF6_CHICK
Gene Ontology:
GO:0005938 = Cellular component: cell cortex
GO:0005768 = Cellular component: endosome
GO:0005886 = Cellular component: plasma membrane
GO:0001726 = Cellular component: ruffle
GO:0005525 = Molecular function: GTP binding
GO:0030866 = Biological process: cortical actin cytoskeleton organization and biogenesis
GO:0030838 = Biological process: positive regulation of actin filament polymerization
GO:0015031 = Biological process: protein transport
GO:0035020 = Biological process: regulation of Rac protein signal transduction
GO:0031529 = Biological process: ruffle organization and biogenesis

Sequence:
>Contig1114
TTGGTAACTACATCACACACCTACTCCCCACACACAAATCTCCCCCTCCA
ATTACTCCCCCGAGGTCTCCCAAAGAAATAGCCATTACTGCCTTTTCGCT
CTTCTTTAGCTTCACGTCAAAATACTTCTCTCTGCCCACGACACGTCCGA
AAACCCGATTATCTTTTCGCGTCGGTTGTTGTCGCGGCAACACCCTCCAC
GTATACAATCCAGACAGGCCCTCCCATCCACAAGGCTCTACTACTGTACT
CGTACGAGGCTCGCTCCCCTCCTTTTCATCTGGTCGAAAGAAATCAAAAC
CTTTGAACTCCTTTCCCGGAACCCACCGTCAAAAAGGTTCAAATAAACAC
GTTAACTTGTCGCTGCTCTTCTTAGAAGCAGCAAGACCACAAGTTCAAGA
TGGGTGGCTCCATATCAAAAGTCATGAGTAAACTGTTTGGAACGAAGGAA
ATGAGGCTACTCATGTTAGGGTTGGATGCGGCTGGAAAGACGACTATTCT
CTACAAATTGAAGATTGACCAGGATGTAACAACAATTCCCACAGTCGGCT
TCAATGTTGAGACCGTAACTTACAAGAACGTCAAGTTCAACGTCTGGGAT
GTCGGTGGTCAAGACAAGATCCGTCCTCTGTGGCGCCATTACTTTTCTGG
TACCCAAGGCCTGATTTTCGTTATCGACAGTCATGATCGTGACCGTATCG
ATGAGGCAAGGCAAGAGTTGCACAGGATTATTCAGGACCGAGAGATGAAG
GAGTCCCTCCTGTTAGTCTTCGCTAATAAGCAAGATATCCCTGGCTGTAT
GCCGCCTTCAGAGGTGACAGAGAAGCTTCAGTTACACAAACTGAAGGACA
GGGTCTGGTATGTGGTTCCTAGTTGTGCCACTACTGGCGAGGGATTGTTT
GAGGGATTGGGCTGGTTGTCCAACAATGTCAAGACGCAAGCTCCCGCCCG
GAAGTAGACAATTCACGTCGTTCCATGCTATTATAACTTTAGGCAGCTAT
TGCCCATAATAGCACTAAGCGGAACTGATGCTGATGTCGGGTTGTATGAT
ATAAGCCCCGTCTCGGACTACGAGCAGGGCCCACTGTAGAACCGTTTATT
TGCCTTTTATTGTCATCTCATGCTCTGGGTGTTTTCTTTACTTGGGTGCT
TCACGTTGGTTATCGCCTTTTTTCTTTTTTTCTTATATTTTCTGCTACTT
ATTGCCCTTTTAATTAATGAAGTTACGGATATTTCAGCCGACTCTTATAC
ACCCTCTTCCTTCCTTCTCTCACTTACTCATTTACCGAGCCCATCTCTCA
TATCCTCAGCGTTATCTATCTATTTCCTTATATCCCGAATATTCCTCCAT
TTCAAAAATACATCCTCTGCGATCTACATCTATTTTCTTTCCTCACCCCC
CATGCATTGCATTTTACCTTTCATGATGCTCCACGAATGTTTGCACGAGA
ATTCAAGTTCTTTTTTATTCTCCCTCTTTTTATTCTTTTTTTTTTCCCCT
CCTTTTGTTACTATTGGTCTTTAGCTTTTCCGCCGAGCCCAGAACCGGGA
GTCGCGTTTTGATATTACTATCATACTCCCAATAGTGGGGATGGGGCGGT
AAATAGAGAACTTGTTGGCACCAGCACTCCTGGGTGGAGTACTGGGTAAT
GTGTAGTATAAGTCGGCAGTATATTGAGAGAATACCCTTTTTTCTTT

Sequences in the Contig:

SY0AAA42YD20FM1 SY0AAB8YI04FM1 SY0AAC10YM07FM1
SY0AAC17YO05FM1 SY0AAC19YB18FM1 SY0AAC19YB18RM1
SY0AAC1YM02FM1 SY0AAD35YJ12FM1 SY0AAD42YP03FM1
SY0AAD47YB08FM1