Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1113
Length(NT) : 825
Best Gene Model Blast : Link to GSTUMT00000748001 E-value : 0.0
Numbers of ESTs : 4

Blast Results:

Nr Definition: hypothetical protein CIMG_05581
Accession: ref|XP_001246140.1| Score: 689 E_value: 1e-70
KEGG Definition: CCR4-NOT transcriptional regulation complex, NOT5 subunit
Accession: aor:AO090011000479 Score: 686 E_value: 1e-70
KOG Definition:
Classification: [Transcription].
Kog Number: KOG2150 Score: 486 E_value: 9e-50
PFAM Definition: NOT2_3_5, NOT2 / NOT3 / NOT5 family. NOT1, NOT2, NOT3, NOT4 and NOT5 form a nuclear complex that negatively regulates the basal and activated transcription of many genes. This family includes NOT2, NOT3 and NOT5..
Pfam Number: pfam04153 Score: 363 E_value: 2e-35
Swissprot: O13870|NOT3_SCHPO
Gene Ontology:
GO:0005829 = Cellular component: cytosol
GO:0030528 = Molecular function: transcription regulator activity
GO:0006402 = Biological process: mRNA catabolic process
GO:0006354 = Biological process: RNA elongation
GO:0006352 = Biological process: transcription initiation

Sequence:
>Contig1113
TTGGAAGAATCAGCGAAGCATGAGGAACCCGCCCATACCAAGAGTTCGAG
GAATGTGCCAACAAGTGAACCAGAGTCTTCTAGGTCGATACCGGAGCCTT
CTCCGTCACCGCTGCCGGAATCACAGACTAATGGAGCGAGCGATAGCTCC
ATGCCTATAGTTGCGTCTCCGGGTCCAGAACCTAGCCCTCCGCCAGCCGA
AGAATCAGTGTACTATCTTCCACCTGGCCTTCAGGATCTAATGTCATCCT
TCGAAAATACCAAGAGGCGCTTGCTTCCCCAACCCGGAAGCCTCCACCGT
TCGCTCGAGATCTCAATGGTTAGCGCACCAGACACGATTGATGCCGAGAA
GCCTCGTCATTATAAGCCAACTACAAAGTACAACACCCCTGCTCATTACC
CCCAGGAGCCGCTCCCTGTCTTTGACGACCCGAGTTTGTACAAGCGCATA
GACGTAGACACGCTCTTCTACGTATTCTACTACCGCCAGGGCACCTACCA
GCAATACCTTGCAGCTAAAGAGCTCAAGCGTCAGAGCTGGAGGTTCCACA
AGCAGTACCAGACTTGGTTCCAACGCCACGAGGAACCGAAAACTATAACT
GAAGAGTACGAGCAAGGAACGTATCGGTTCTTCGATTATGAGTCTACGTG
GATGAATCGCCGTAAAACAGACTTCAAGTTTGCGTACAAATACTTGGAAG
ACGACCTTTAAACTGTCTGCCTATCTGCCTATCTGTAAGGTCGGCCGTTC
TCGCATCGGAGGGAGTTTTTTTCACTTTTTTTTTTCACTTGCCATTCTTC
ATTTCTGTTTCCTGTTCCTTTCGCC

Sequences in the Contig:

SY0AAA42YD16FM1 SY0AAB15YH02FM1 SY0AAC49YD06FM1
SY0AAD39YD19FM1