Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1112
Length(NT) : 1868
Best Gene Model Blast : Link to GSTUMT00010780001 E-value : 0.0
Numbers of ESTs : 19

Blast Results:

Nr Definition: hypothetical protein SS1G_00656
Accession: ref|XP_001598567.1| Score: 595 E_value: 3e-59
KEGG Definition: predicted protein
Accession: mgr:MGG_05110 Score: 522 E_value: 4e-51
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig1112
TTGGCCAGAAGGAAGCCCCTTAATCCTCCAACCCTCCTTTTCTCCTCCCT
CCAATTCTAAACGTCAGAATTTGAACAAACCCCAGGCGGGCCCACCCACA
AGCGAACTCTCGTTTTCCCTCTAACCTAACCAACTCTTTCGCTCTTGGTT
CTTGCCCTCCGCTCCCGAACATCTTTGTCGCCGTGAACCTTTTTCTTCCC
AGGATCCGACCTACGAGTTCAAAGCTCACCGGATAATTTTCCCTAATCTT
TATCTGAGGGTCGCTCCTCCCTCCCCACCACGATGGATTATGCACACGAA
AAATACAACTGGCTTTCGAACCATCTTCCATTCAAGACAGCCGGCAAGAA
GATTTTAATCATCGGTACCGCGTCTGTTTTCGCCTTATGGTTTCTATTCC
TTTTCGGTCCGTCTGCAGCAAAGACCGTCTCAAGCATTAATCTTCCGAGC
TCGGCGAATAGTGCTTCGCCTGACCTTCTTCCAAACGTTACATGCAACCC
TGAGCCGGTAGCGGAGATCCAGAAGCCCCATGAAGAACCTCCTGCCCCCA
AGTTCAACGAATCCAAGGTCGCTTTGCTTATCGAGGATCGCCCCGTCGCT
CACGTTGCTCCCCTCCTTCTTCACATGATCTCCGTCGTACCAGAGGATTG
GAAATTCCAGTTTGTCGGTTCTGAGGCTTCTATACAGTTCTTAAACAAGT
CTTTAGGCGTGCAGCGACAGGAGGCCAGGGGAAAGCTCGAGATGGTCGTT
CTTCCTAAAACCTGGTCCGTCAAGGGACAAGAGCCGCTGTCTAGGACTAT
GACCGACATCGAATTCTGGAAGTGGGTTGGTGGGAAATCTAGTTGGGATT
GGACTGACCCCTACATTGATCAAATGGTCACAGGCCCCGATGGAAGGGAG
ACCAAACGTACTCAAGTCGAATGGGTTTTGGTTTTCCAAACGGACAGTAT
CATGTGTGCAAACAGCGGCGTTTCGCTTAACTCCTGGCTCGACTACGATT
ACGTTGGAGCTCCTTGGGGACCTGGTGATGGTCTCGGTGGTAACGGTGGA
CTCTCGCTCCGTCGTGTCAGCCGTATGATCCAAGTTCTTGAAAACGACCA
CCGCCCTGAAAACGACGGTGCCCTCGAGGATCTTTGGCTGGTTCAACGTC
TTCAGCTCCTTCCGGGTGCCAAGATGGCCAACGGTACGACCGAACAGAGG
TTTTCTGTAGAGCAAGTCTGGCATGACGAGCCCATGGGTTATCATCTTGG
ATGGAGTGGAGCACGTCTACCTGAAGGAGTCTGGGATGACAAGGAAAAGC
GAGACAAAATCTGGAACTGGTGCCCGGAAATTAAGCTGATCCTCAACATG
AGGTTAGAAAGGGAGGGATGTCCTGATGGACAACCGTCAAAGTTAAAAGC
AAGAGCCGCCGAGGAAGACTGGACGAGACGGTTGAAGACGTTCTAATGGG
TATTGGGGATAAAAATTTTCTTGCCACATACTTTTCTAGGGAGTTTATGA
TTTTACGTTTGAATTTTTCTTTTTTTCTCTTTGATTCATAAGGAATGGGG
TCCTTTTTCACTTTTTTCACCCTTCCACCTTCTGTTTTGGCTTTGATGGA
TTAGGAGATTCGCTCAGCGAACTTTCCGAAGGCCGCTGGCGGTGACACTG
CATCACTTGTCATTTCTTCGTGGCTTTTCTTGCTCGAACCAAAACAATAT
TTGAGCAATGGTGTGGGCGTAGGGGTTAATGATAGAAACATACCGGTAAT
TGATGCTTGTTTTAAGTGCGTATGCTATACTGGATAGTTGCTCGTTCTAC
TGTGGCTGAGGGCGAGTTGCGATGTTTATTATATCCCATCATGATTAAGA
ACTTTTTGTGTTTGCCTT

Sequences in the Contig:

SY0AAA21YI05FM1 SY0AAA28YD07FM1 SY0AAA36YG05FM1
SY0AAA42YD07FM1 SY0AAA43YJ18FM1 SY0AAA43YM22FM1
SY0AAA48YC21FM1 SY0AAA5YA11FM1 SY0AAA60YG12FM1
SY0AAA7YL17FM1 SY0AAA8YM16FM1 SY0AAA9YC21FM1
SY0AAB10YL11FM1 SY0AAB14YN03FM1 SY0AAB6YF11FM1
SY0AAC21YK10FM1 SY0AAC21YK10RM1 SY0AAC30YH14FM1
SY0AAD2YJ11FM1