Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1111
Length(NT) : 809
Best Gene Model Blast : Link to GSTUMT00010743001 E-value : 0.0
Numbers of ESTs : 11

Blast Results:

Nr Definition: conserved hypothetical protein
Accession: ref|XP_001595561.1| Score: 508 E_value: 1e-49
KEGG Definition: hypothetical protein
Accession: ncr:NCU06541.1 Score: 492 E_value: 4e-48
KOG Definition:
Classification: [Carbohydrate transport and metabolism].
Kog Number: KOG4472 Score: 458 E_value: 2e-46
PFAM Definition: Glyco_transf_15, Glycolipid 2-alpha-mannosyltransferase. This is a family of alpha-1,2 mannosyl-transferases involved in N-linked and O-linked glycosylation of proteins. Some of the enzymes in this family have been shown to be involved in O- and N-linked glycan modifications in the Golgi..
Pfam Number: pfam01793 Score: 485 E_value: 1e-49
Swissprot: P27810|KTR1_YEAST
Gene Ontology:
GO:0005794 = Cellular component: Golgi apparatus
GO:0000026 = Molecular function: alpha-1,2-mannosyltransferase activity
GO:0000032 = Biological process: cell wall mannoprotein biosynthetic process
GO:0006491 = Biological process: N-glycan processing
GO:0006493 = Biological process: protein amino acid O-linked glycosylation

Sequence:
>Contig1111
TTGGGGGCAGCGAATCTCCTTTTCTTTTCTATATTAATCAACGCCACCAT
ACAAAAAGTTTCATCAATCCCCCTTCAAAATATTTTCCTGCTTTTGCCAT
CTTGCTTCTTTAGCTTTCTTTGTTCTTGTTGAATGGGAGACTCATCAGAC
TAGCTTTCAAGGACCATCTCACCTCACCGCTTTCTCCAGCTTTGTTACTT
TTCCTCATCTTCCTCCCCTTTCCTTTTTTCCGCCTCCACTCGTCCGTTAA
GATGGCAGCGAATAGTCGAACCTTACGGTTCATACTATTAGCTTTCTTCT
CGATAGCTGTCCTTTTCAAAGTATACACTTCAAACTACCATGCCGGGACA
CCACTGGTGGACGTCGAGAAGATCGCCGAGCAACAGCATGCGCAGGATTC
ATCATCTTCCCCATCGCAATCCAACGGCAATAATGGGTTTTCCTCGAACC
CTGCAAGCGGCCTCCCGGCTGGAGTTCATGCCGGAAAGCGCGCGAACGCT
ACGTTTGTCACGCTGGCGAGGAATAGCGATGTCTGGGAGATTGCAAAGTC
TATTAGACATGTTGAGGATCGTTTCAATCGGAAGTTTAATTACGACTGGG
TTTTTCTGAATGACAAGCCTTTCGATTCGCAGTTTAAGAAGGTTACTTCC
GCGCTCACTAGCGGGAAGGCGAAGTACGGGTTGATTCCACACGAGCACTG
GAGTTTCCCGGATTGGATTGATCAGGATAAGGCGAAGAAAGTTAGAGAGG
ATATGGCCCAGCGAAAGATTATCTACGGCGATTCCATCCCTTACCGACAC
ATGTGCCGT

Sequences in the Contig:

SY0AAA41YA21FM1 SY0AAA42YD05FM1 SY0AAA43YI09FM1
SY0AAA49YC22FM1 SY0AAA63YD08FM1 SY0AAB58YJ19FM1
SY0AAC15YG01FM1 SY0AAC61YG22FM1 SY0AAC61YH11FM1
SY0AAD12YI05FM1 SY0AAD45YF12FM1