Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1110
Length(NT) : 698
Best Gene Model Blast : Link to GSTUMT00009599001 E-value : 4e-51
Numbers of ESTs : 3

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig1110
ACCCCCCCCCACATTTTACTGAGATCACGGACAAAAAGAACAATTGCACA
AAAAAGCAAACTAGACTCGCAAACACTCGCGGGAAAAGGCAAGGAGAAAC
AACCATGATAGCAGTATAATGAACGACCGAGCAGAGTAGAGGAAATATAG
AAAAAGTGTATTAAATAATCCCCCTCATACAATCACCACCTCCCCCTCCC
CAACAACCCTATCAGTGCCCACTACTACCAACAGTTTTAAAGGTAGTACA
CAGAAGAGTTTTTTTTTTTTCGGTAAAAAATGTAAAACAAAACAAATACA
AGAGATAGGAAAACACCTAAGGCTTGCAGGAAAGGAATGGTGGGGAAATA
TGTAAGTAAAGGAAAATGAAGAAAAAAATAAGTGAACACAAGCACGCTAT
GTCTACCCCATTAACATGTTGGGCAGATAGAGAGATAAACAGATAGGACC
TCGTCTGCGTCCTCGCCTGTGCAAGGGAACCAATTTTGCCCGTCGGAGAT
TTTGATTGTTCAAGGATTTGATCCGCCGCCGCTACCGCCGCCACTGTTAT
TGTTATTTTTCCGCAAAACGGTGACCAAGACTGCGATGATGACGATGACA
ATGATGATGAGAAGGACGATGAGAAGGCACCACCACTTCTTTCTTCTTCG
GGAACGAGCTTTCTCCACAGCCTCTCCAATCTCTTCTTGGGCCTTGAC

Sequences in the Contig:

SY0AAA42YC14FM1 SY0AAC26YF06RM1 SY0AAC31YI16RM1