Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig111
Length(NT) : 1654
Best Gene Model Blast : Link to GSTUMT00009963001 E-value : 0.0
Numbers of ESTs : 14

Blast Results:

Nr Definition: hypothetical protein SS1G_04409
Accession: ref|XP_001594602.1| Score: 564 E_value: 1e-55
KEGG Definition: C2H2 transcription factor (Seb1), putative, putative
Accession: afm:AFUA_4G09080 Score: 454 E_value: 3e-43
KOG Definition:
Classification: [Transcription].
Kog Number: KOG2462 Score: 160 E_value: 1e-11
PFAM Definition: No Hit Found
Swissprot: P39959|YEW0_YEAST

Sequence:
>Contig111
TTGGAACCGCAGCAGGTCTCCAAGGTGAAAAGCCTCTAGTTGATGGCTGC
AATGGTACCATTACTCCGTCAGATATCCAACTTCCTGACACTCCCGAGAT
ATGGAGAGAGAGCCCTCCCATGACTCCAGCATATATTTATCCTCCTAGTC
TGCTCCCAACCCACTCGAGCCCTTCGGTTCTCTTGCCGACTTGCCCCTCA
TTGTCACCAGCTTCGGATCACTCATCATCTCCGGAGCTCGATTTCTGTGA
TCCACGAAAGCTCACATATCCGTCACCCAATCCGTCCGCTTCTGACAAGG
ATTTGGAGTTTGCTACTCTTCCTTCCATTCGCGATGATGATGACGAACAC
AACTTCATGCTCGGTATGGGAAAGGACGATATTAAGACCGAGGGAAGGGA
TTTTGCCCACGGCTTCCTTGGTCTCGAGGAGCAACTCTCTGACTTCGAGT
CTGATAACGAGCTTGTCTCCGGATTGATGAACATGCCACAGAACACCATC
AACCCCGTCGATCTTCTCGGAAACAGGCGTCAGCGTGATGGCTTTGATGA
CGAGGAGGGCTGGGAGATGGATGACCTGAGCGATGATGAGAGCGTATCTG
GTGATATTAACAGCCAGGAATTTCAAGCACCGTTGTCTCCTCCTCCATCT
GATTCGTCTCGAGGAGGCTCCGCAATCCCTCCCACCAAGCAACGCAAGGT
TCAGAGGAAGATCAAGGCTGAGACGTATGAAGACTCCGAAGCGGAGCTCG
ACGATATAATTGCCAACGCTCGAGCAAACGGGTACCCCGAAAGTACTTGC
GATGGTGATTTCTTTTCGCACTCTAGCTGCCATGAATCATCAATCACACC
TGCCCCAACCGAATCATCCTTCTACGAGTCTTCGGATTCGCAGGTAGTTT
CCCCAGCACCCGTCGTCCGCCGTGGACGTAAGCAGTCTTTGACTGAGGAT
CCCTCAAAGACTTTTGTGTGCCACTTGTGCTCCCGCCGCTTCCGTCGACA
GGAACACCTCAAGAGGCACTTCCGCTCTCTTCACACCAAGGATAAGCCCT
TCTCTTGTGGCGAATGTGGCAAGAAATTCTCACGTTCTGATAACCTGAGC
CAGCATGCACGAACTCACGGAAGTACCACCATTCACATGACCCTCATCGA
TGGTGACATGATGGGCGAGGATGATTCGGATGTGCTTTCAGAGCATAGCG
AATCATTAGGCATTGTCCTTGTCAACGCAACCCAAGCCTCATCGGGGATC
AAGGATAAGATTTCTTCCTCATCACCAGAGTCCAAGAAGAGCCGACGTAA
GAGAAAGAGAGACGAGTAATGGTAACACGACGGATGCCTGGGCGTGTGGT
TAGCATAGCGAAAACATTTGATTTTCGGGCGCTATTATTTCTATTGTTTT
ATTGTTTCCTTTTTATCCCTTCTTTTCTTCCACATTGAATTTTATTCGAT
TCCTTGTTACATGGTGATTGGGAGGTTTAGATACCAGGTGTATGGCGGCG
GCAGGGGCTTGGGGTAGGCACAAAAGAAATTAATGCGGCGCTTATATTTG
GGGATTGTGATTTGTCTTTTTTTCTTTTCACTTTTATTCTTATTCCCATT
GCGTTCAATTCTCAGTAAGAGGAGGATCTCCGATTGAAAAAAGGAAGCTC
ACGA

Sequences in the Contig:

SY0AAA10YK21FM1 SY0AAA12YL21FM1 SY0AAA14YD16FM1
SY0AAA45YM09FM1 SY0AAB15YG05FM1 SY0AAB21YH14FM1
SY0AAB40YN05FM1 SY0AAC1YM17FM1 SY0AAC27YH03FM1
SY0AAC2YP07FM1 SY0AAC41YP01FM1 SY0AAD21YO07FM1
SY0AAD27YH21FM1 SY0AAD63YB24FM1