Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1109
Length(NT) : 1172
Best Gene Model Blast : Link to GSTUMT00001582001 E-value : 0.0
Numbers of ESTs : 7

Blast Results:

Nr Definition: mannosyltransferase PMTI
Accession: ref|XP_747257.1| Score: 901 E_value: 1e-103
KEGG Definition: mannosyltransferase PMTI [EC:2.4.1.109]; K00728 dolichyl-phosphate-mannose-protein mannosyltransferase
Accession: afm:AFUA_8G04500 Score: 901 E_value: 1e-104
KOG Definition:
Classification: [Posttranslational modification, protein turnover, chaperones].
Kog Number: KOG3359 Score: 726 E_value: 2e-77
PFAM Definition: PMT, Dolichyl-phosphate-mannose-protein mannosyltransferase. This is a family of Dolichyl-phosphate-mannose-protein mannosyltransferase proteins EC:2.4.1.109. These proteins are responsible for O-linked glycosylation of proteins, they catalyse the reaction:- Dolichyl phosphate D-mannose + protein <=> dolichyl phosphate + O-D-mannosyl-protein. Also in this family is Drosophila rotated abdomen protein which is a putative mannosyltransferase. This family appears to be distantly related to pfam02516 (A Bateman pers. obs.)..
Pfam Number: pfam02366 Score: 585 E_value: 6e-61
Swissprot: O42933|PMT4_SCHPO
Gene Ontology:
GO:0031502 = Cellular component: dolichyl-phosphate-mannose-protein mannosyltransferase complex
GO:0004169 = Molecular function: dolichyl-phosphate-mannose-protein mannosyltransferase activity
GO:0046982 = Molecular function: protein heterodimerization activity
GO:0000752 = Biological process: agglutination during conjugation with cellular fusion
GO:0000917 = Biological process: barrier septum formation
GO:0000032 = Biological process: cell wall mannoprotein biosynthetic process
GO:0035269 = Biological process: protein amino acid O-linked mannosylation

Sequence:
>Contig1109
AGCCGCGTCAACTGCTGTGAAAGTCTCCCAATTCATCACCACTTCTCTGG
GATAAGGAGAGCCACCTCTCCACTTCGAGACTTCCCCTCCACCACTACCA
CTACCCTTCGTGTCTTCCTCGCCTCACCCCCTTTCTTCTCTTCTAATATT
ATTATAATACCACGTAGCCCGCCCGCTTCTAACAACTACAACTTCATTCG
TTTTTTCTTTCTTACTCCTATTCTTTAGCTTTTTTTTTCTTCTTGTGCAT
CTATCCTTTGTTCTTCGGCTAAAATCGCTTTCCTTTGATTTGATTTGAGA
ACACGTTTATAGATTAGCCATGTCGGATTCCCCTCCGAGTGTTCGCCAGC
GCGCCTCGAAGAAGAAGGGTACGGCGCAGGCTGTACTGAACTCTGGATCG
GGCTCAAATTCTGAGGACGAACTGCTCAGCAAGAAACAGAAGGTTTCTGC
GCCTGTCCCGGGTGCATTCGGTCATGCCCAAGGCCCGTTCCGAATCTGGC
TCTTCTTGTTGACCGCTGCGGGCATCATTACAAGATTCTACAAGATTAGC
CATCCTAATGAAGTAGTCTTTGACGAGGTCCACTTTGGAAAGTTTGCATC
CTATTATCTTCAACGAACTTACTTCTTTGATGTCCATCCTCCGTTTGGGA
AGCTCCTTTTCGCCCTGATGGGTTGGTTCGTTGGTTATGATGGTCACTTC
TTGTTTGACAACATTGGTGATTCCTACATTGACAACAAGGTCCCTTATGT
CGCATTCCGCGCCATGCCCGCCATGTTGGGTGCTTTGACGGTCCCAGTGG
TTTTTTTGACTATGTGGGAAAGCGGCTACAGCCTTCCTGCTTCAATTGTT
GCCGCCGGGTTAGTCTTGTTTGACAATGCGCATATCGGCCAAACTCGTCT
CATTCTCCTCGATGCTACTCTTATTTTCTCGATGGCTTGCTCTCTCTTAT
GCTATGTCCGGTTCTACAAGCTCCGTCATCTCCCATTCAGCCGCAAATGG
TGGAAGTGGCTGCTTTTGACTGGTGTAGCTCTATCATGTGTCATTTCCAC
CAAATACGTTGGTGGTTTTCACCTTTGTGACAATTGGCGCTGCTGTCGGA
ATTGATCTCTGGAACCTTCTTGATATCAAGCGTGGCTTGACAATCCAGGA
ATTCACCAAGCACTTTATTGCA

Sequences in the Contig:

SY0AAA10YF11FM1 SY0AAA25YD03FM1 SY0AAA42YC12FM1
SY0AAA5YF05FM1 SY0AAC43YA13FM1 SY0AAC50YD13FM1
SY0AAC51YC22FM1