Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1108
Length(NT) : 1606
Best Gene Model Blast : Link to GSTUMT00004053001 E-value : 0.0
Numbers of ESTs : 93

Blast Results:

Nr Definition: hypothetical protein CIMG_06712
Accession: ref|XP_001242816.1| Score: 246 E_value: 7e-19
KEGG Definition: hypothetical protein
Accession: fgr:FG09455.1 Score: 221 E_value: 3e-16
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig1108
TTGGCATTGGTTTGCCTTCAATCAACTATCAGCTTCCTCTCAGGAGAACA
TCGCTTCTTGTACTGTACTGTACGCGTGCTGTAACACCTTTTCTCTCACC
CGATCAAGCCATTCATCTCTAGGCCACTTAACAGAAAAAGCAAAGGAGAA
ACATACCGCAAAACACATTCTACAAGTTTGCTCTGTTACCTTTCTCGGAC
CGCCGCATAACTTTGTTGTTCACTCAACCCCGCTTTTCTCTCGAGGAGGT
TTTTTAAAACCCCCTCATCCGTTACCAAAGAGCCTAGTTTTCCTTCGCTC
TAGAAACCCGCCACCAGCGAATCCTTTATTCTATCATTTTTGGAACTCCC
AAAAAAAGAAGTCTAGACATGGCAAGTATTTCTACTATCACTCCATACAC
TTCCTACGGAAACCCGCATACTTCCACGGGTGCCCTTGTACGCGGCGGTG
TTATCGATGAGCCCGTTGTCGAACATGAACACCATCACGTTCATCACCAT
ATCGATCATGGCAATCCGGTAGCCGGTGCTCTTGTCAGGCCCCGTGTTGC
ACGCGAGTATTCCTATGACGACCTTCACGACCGTGAACGCAGATATGGTA
GTGGTATGAGCTTGGGTAGTTTTGGCCACCACCATGGCCACCACTATGGG
CACCGTCATCGTGGGCTCCTTGGGGGCCGGTTTGCCCGATCAGATATCGA
TCTCAACCTGGATGCATCATATAGGCATCGGCGAAGAAGCATCTATGATG
ATAGAGATTCGGAACTTGCAATTATTGATGTTCCTGCTGGAACCCGTCGA
GTGACTGTCGACATGGGTCGGGAGGTTGATATCAACTGGAGGCGGGATAA
CGGCGTTCGGAGATCAAGGGGATTGGGGAGTGAGCTCTGGACCGAGATCA
CTAAGGACCTTGTCACCAGAGAGGCCATTGAGGAATGCGGATACCCGTAT
GAGGAAACTGAGTTCTTCTACTATATCTTTGATTACCTGCACCGTGAGCA
GATCAACGAGTTAGTGGATCTCACCCACGAGATTCGCAGACATCGTATCC
GAGACCTTGAGTATGAGTCGATTGGCGTAGGTCACCCTCGCTTTGACAGG
CGACTAGATTACGATCGCGAGGAGACTCGCACCGAGATCGTTATTGAGGG
TGGCCACAGGGGTCATCGCCGCCGCAACCGCTATTACTACTAAATGCTTC
CCCTGAACGCTGTATTGCGTTCGATATTTGATCAATTTAACGACGTGACG
ACCTAGATTGGTTTTTTCCTTCCGGTGTTTCGTCCGAGGGCTTTTTTTCT
CCTACAAATGTTTTCTTTTTACATCTCACTTTTGCAAGATTTTTCAACCA
TTTTCGTTTTCTTCTGGCCGCTGCACTTACTTGTTCCCGAGTTTAGTGTC
GTGCCTAGTCCAATGTATTTCCTCTTTTTCTTTAACGACTTTCCGTTTTC
TTGTCCCAATAGTATTCCCTCTCTATTCTACTCGTATAATGATCTTGTAA
CCGGTAGTGGACACGTGATGATGGCGAACATGTTTTCATCTTCTGTAACT
TGGGGGAAAGGGAAGTGGGTTAAATCTTCGTGGAATCGTACATTTTCGTT
CGCAAT

Sequences in the Contig:

SY0AAA10YF06FM1 SY0AAA10YG24FM1 SY0AAA11YA04FM1
SY0AAA13YD07FM1 SY0AAA15YA24FM1 SY0AAA15YH14FM1
SY0AAA16YA02FM1 SY0AAA17YO05FM1 SY0AAA19YB18RM1
SY0AAA20YI18FM1 SY0AAA21YI19FM1 SY0AAA22YA21RM1
SY0AAA23YC15FM1 SY0AAA24YB07FM2 SY0AAA26YD16FM1
SY0AAA27YL15FM1 SY0AAA2YA19FM1 SY0AAA2YK03FM1
SY0AAA30YN03FM1 SY0AAA30YN03RM1 SY0AAA31YB08RM1
SY0AAA31YL14RM1 SY0AAA31YM20FM1 SY0AAA31YO14FM1
SY0AAA32YF04FM1 SY0AAA32YF04RM1 SY0AAA33YG05FM1
SY0AAA34YJ10FM1 SY0AAA35YB02FM1 SY0AAA35YF04FM1
SY0AAA36YN08FM1 SY0AAA37YJ24FM1 SY0AAA38YI12FM1
SY0AAA3YJ19FM1 SY0AAA41YD11FM1 SY0AAA42YB22FM1
SY0AAA42YG06FM1 SY0AAA42YN21FM1 SY0AAA45YE06FM1
SY0AAA46YE11FM1 SY0AAA46YP03FM1 SY0AAA48YH10FM1
SY0AAA49YD09FM1 SY0AAA49YM23FM1 SY0AAA4YM18FM1
SY0AAA52YG22FM1 SY0AAA53YD20FM1 SY0AAA53YI23FM1
SY0AAA54YP14FM1 SY0AAA55YF08FM1 SY0AAA57YH11FM1
SY0AAA57YN12FM1 SY0AAA60YN17FM1 SY0AAA61YJ14FM1
SY0AAA6YO11FM1 SY0AAA8YA07FM1 SY0AAB11YE06FM1
SY0AAB12YE12FM1 SY0AAB13YG01FM1 SY0AAB16YC11FM1
SY0AAB16YM06FM1 SY0AAB17YG23FM1 SY0AAB18YF04FM1
SY0AAB1YF12FM1 SY0AAB21YO05FM1 SY0AAB23YL22FM1
SY0AAB26YG05FM1 SY0AAB26YL08FM1 SY0AAB28YA09FM1
SY0AAB2YF22FM1 SY0AAB31YD01FM1 SY0AAB35YD16FM1
SY0AAB35YP02FM1 SY0AAB37YH04FM1 SY0AAB37YO11FM1
SY0AAB3YF12FM1 SY0AAB40YF05FM1 SY0AAB40YI13FM1
SY0AAB41YH12FM1 SY0AAB42YF04FM1 SY0AAB42YM13FM1
SY0AAB44YJ19FM1 SY0AAB48YG14FM1 SY0AAB49YB10FM1
SY0AAB51YA14FM1 SY0AAB52YO23FM1 SY0AAB56YC16FM1
SY0AAB57YF20FM1 SY0AAB5YB20FM1 SY0AAB7YA04FM1
SY0AAC3YK24FM1 SY0AAD47YD10FM1 SY0AAD57YG11FM1