Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1107
Length(NT) : 2099
Best Gene Model Blast : No Hit Found
Numbers of ESTs : 19

Blast Results:

Nr Definition: hypothetical protein BC1G_12178
Accession: ref|XP_001549450.1| Score: 1440 E_value: 1e-157
KEGG Definition: glucokinase [EC:2.7.1.2]; K00845 glucokinase
Accession: ani:AN8689.2 Score: 1418 E_value: 1e-155
KOG Definition:
Classification: [Carbohydrate transport and metabolism].
Kog Number: KOG1369 Score: 1082 E_value: 1e-118
PFAM Definition: Hexokinase_1, Hexokinase. Hexokinase (EC:2.7.1.1) contains two structurally similar domains represented by this family and PFAM:PF03727. Some members of the family have two copies of each of these domains..
Pfam Number: pfam00349 Score: 576 E_value: 1e-59
Swissprot: Q92407|HXKG_ASPNG
Gene Ontology:
GO:0004340 = Molecular function: glucokinase activity

Sequence:
>Contig1107
TTGGCAACCATCGTCTCTCCCCATTCCATCTTTTAAGCCTTCTGCCAAGG
TGAAGTCCCCAGCCTCGACTCTCTCCTACTTTGTCTCGACTTTTCGTACT
TTATCACTCGCCGTTGCCTTCAGCGCTGCCTTTCTGCAGTTCTTCATTAA
TCCGTTCATACCGACACCGACTCCCCCAAATTTGAAGAGCGGTCCGACGA
GTGCGACAAGGCTAGCGGCTGGTGATATATTCGGGTGTCAAAGTACAAGT
GCTGCAGAGAAATTTGTACGGGGTAACACAGTTTGCTCCCGACTTGGACA
CGAAGACATTTTCTTGAGGGAGTCCCCATTGTTGCCGAGGTCTTCTGAAA
AAGAGACTCCAGACGTTGCATTGTCAGAGAAACAATTTGAGAAGGAAGCC
TCTGTAATTGAGCCCCCTTCATCTGCCAACAAGAAGCCGCACGCAGTCTC
TCGGAATCCTGACGAGATTTCCCCTGAGTCCTTGACTTTATCTGAGAGCA
TTTCCTTGTCTGAGTACGCTTCCAGAGTCACGTCACAACGAACCCTGAGC
ATGTCGCTTGTGGGGAAGGCTACCGAAATTGCCGAGGAGCTTGAGTACTC
CCCCGAGCAGGTTCGTAATGGCGTTAAGGAATTTTTGAGGTTGATGGACG
ATGGGTTGCAGAATGATGGAAAGGATATGACGATGATCCCAACATATGTT
ACTAGTGTTCCTAATGGAACTGAGAAGGGGGTCTATCTTGCCGTCGACCT
TGGCGGTACCAACTTTCGTGTTTGTTCGGTGGTCCTAAATGGAGATACCA
CCTTTACTCTCACTCAGTCGAAGGTCGCTATCCCGAAAGCTTTGATGGTT
TCGGATTCCCATTCGCTCTTCTCGTTCCTTGCCAAGCAGGTAGCCGATTT
TGTCGGGGAGCATCATTCGGATCACTTTTCCGAGGACCCAGAGCACCATT
TACACCTTGGATTCACTTTCTCCTTTCCTGTCGACCAGAAGGCCATTAAC
AAGGGCTATCTCATTCGGTGGACCAAGGGCTTTGACATTCCCGATGCTAT
TGGCAAGGATGTCTGTGCGCTGCTCCAGAAGGAAATTGATGCTCTAGGCC
TCCCCGTCAAGGTTGCTGCCTTGGTTAACGACACTGTTGGAACCCTGATG
GCTAGATCGTACACTTCCCCGGGAAAAACCGGGACACTGCTTGGTGCCAT
TTTCGGAACCGGAACCAACGGGGCCTATGTAGAGAAGTTGGACCGCATTA
CTAAGATGACTTTAGCTTCTGCTAAAGATGTTGGTGAATACGACGCTTCA
ACCGGCGAGATGGTTGTCAACACTGAATGGGGAAGTTTTGATAATGCTCT
GAATGTTCTCCCCGACTCGCCTTATGACAGGATGCTTGACCAGAGTTCAG
TCAACCCTGGGATCCAAATGTTTGAGAAGCGTGTTAGTGGAATGTTCCTT
GGAGAGATTCTACGAAATGCAATTCTTTCAATGAAGAAGGATGCAGGATT
GTTTTCCACTTCTACTATCGCAGAAGATTCAATTCTGAGTACGCCCTGGA
GTATAGATACCTCTTTGCTATCTTACATAGAAGCGGACTCGACCAGCGAT
TTCTCTGTCACCAAGGAGCAATTGCAGAAAGACCTGGGAGTTTCTGCGTC
CACCATTTCCAATGATGAAGCACAGGCGGTTAAAATACTTGTTCACGCAA
TTGGTAAGCGGTCAGCCCGTCTATCCGCGGTACCAATTGCAGCTATTATT
ATTGCGACAGGCAAACTCTCACCTCCTGTCCAAACTCCGATTGATGGTCT
GAAGGACCTGTCGCTTGTGGGACAGGGCATTGAGATCTTGAGGAGAGCAA
TTTCCGCAAGGCCGTCGGCTGTTCCATCCGTCGATGCACCACCAGATATC
CAAGATGAGGACCCTATTGATATAGGTGTTGACGGAAGTGTTGTGGAATT
CTATCCCGGTTTTGAAAAGTATGTCAGGGAGGCCCTGAGAGATGTTCCCG
AGTTTGGTGAGAAAGGCGAGAAGCGGATTAGGATGGGTGTTGCCAAGGAC
GGTAGTGGGATTGGAGCTGCCCTGATTGCATTGGTAGCCAAGTTGCAAT

Sequences in the Contig:

SY0AAA33YK24FM1 SY0AAA42YB05FM1 SY0AAA48YI09FM1
SY0AAB12YA19FM1 SY0AAB18YA12FM1 SY0AAB25YB01FM1
SY0AAB29YO19FM1 SY0AAB56YF08FM1 SY0AAB57YF08FM1
SY0AAB8YA12FM1 SY0AAC29YL20FM1 SY0AAC33YH12FM1
SY0AAC35YB15FM1 SY0AAC60YH15FM1 SY0AAD23YP07FM1
SY0AAD42YC18FM1 SY0AAD42YG18FM1 SY0AAD55YH01FM1
SY0AAD60YM13FM1