Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1106
Length(NT) : 714
Best Gene Model Blast : Link to GSTUMT00007844001 E-value : 0.0
Numbers of ESTs : 3

Blast Results:

Nr Definition: hypothetical protein AN9160.2
Accession: ref|XP_682429.1| Score: 540 E_value: 2e-53
KEGG Definition: hypothetical protein
Accession: ani:AN9160.2 Score: 540 E_value: 8e-54
KOG Definition:
Classification: [General function prediction only].
Kog Number: KOG0725 Score: 317 E_value: 3e-30
PFAM Definition: adh_short, short chain dehydrogenase. This family contains a wide variety of dehydrogenases..
Pfam Number: pfam00106 Score: 217 E_value: 1e-18
Swissprot: P37440|UCPA_ECOLI
Gene Ontology:
GO:0005515 = Molecular function: protein binding

Sequence:
>Contig1106
TTGGCTTGGCCTTCCGCCGGTAGTTGACTCAGTATATTCACCACCATCAC
CTCCTCGTTTGTTTCCTCTTTGCAAGAGAACAGAAATAATTAAGTCGTTC
TCTTCAATTCTCACGCAATGGCTACGCCGAGCAAGTTCTCCCTCCAAGGT
CGCACTGCCCTCATAACTGGCGGCTCCCGCGGGTGCGGTCTCGCCTTCGC
TGAAGGCCTTGCAGAGGCCGGCGCCGACATCGCCGTCTTCGACATAATCC
CACCAACCCCGGGCTTTCTCTCAATCTCCGAACGCTTCAGCGTCCGTGCC
GTGCACTACCTCGCCGATGTAGCCTCCCCCGACTCACTCGCTGCCGCCTT
TGAGTCTTTCAAAAAAGACTTTGGTGGCAAACTCGATATATGCGTCCCCT
GTGCTGGGGTCAACAAGAATGTCGAGTTCTTAGATACCACTTGGGAAGAC
CATGAGAGACTACTTGGCGTTAATGTCATGGGGGTTTACCATACTGCACA
ATTAGCTGCGAAGACTATGATTGAATATGGGACCAAGGTTGGGAGTATTG
TTGTGATTGTTAGTATCGCAAGTTATATGGCTATTCGCAGTCAGAATAGT
AGTGCGTATTGTGGGACCAAGGGGGCGGTGAGGGCGATGGTGCCGGGTAT
TGCAGCAGAGATGGTTAAATATGGTATCCGCGTGAACTCATTGTCGCCTG
GATATGTGCGGACG

Sequences in the Contig:

SY0AAA42YA21FM1 SY0AAB60YC03FM1 SY0AAD36YO13FM1