Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1105
Length(NT) : 1133
Best Gene Model Blast : Link to GSTUMT00011846001 E-value : 0.0
Numbers of ESTs : 5

Blast Results:

Nr Definition: putative lipase 2
Accession: gb|ABG67898.1| Score: 700 E_value: 1e-71
KEGG Definition: hypothetical protein
Accession: ang:An08g08290 Score: 509 E_value: 7e-50
KOG Definition:
Classification: [General function prediction only].
Kog Number: KOG1516 Score: 418 E_value: 1e-41
PFAM Definition: COesterase, Carboxylesterase..
Pfam Number: pfam00135 Score: 629 E_value: 4e-66
Swissprot: P22394|LIP2_GEOCN
Gene Ontology:
GO:0004806 = Molecular function: triacylglycerol lipase activity

Sequence:
>Contig1105
TTGGTAAGGCTCGGGACCTTCGCAACAAAATCATTTTCTTCGACACAAAC
ACATTCCATGACAACATGGTTCAAATTGGGTTGAGAGAAATATTTCTCCC
TTTACTCCTCCTCATCGGGGGTGGGAGCTGTGCGACGTCCTCCCTACCAA
TTGTTGACCTTGGATACGTCAAGCAACAAGCCACCTCTTATAACAAAACT
TATGATTTCTACCACTTTCGTAATATAAGATATGCGGCGCCACCTCTCGG
TAATCTTAGATTCCGTAAACCTCAACCGCCGCTTCCTCAGACTGGAATAC
AAAATGGAGACATCCCACTTTTAAAGAGTGTCTGTCACCAGAACCCTCTA
TCCTTCCTATCCTTCCTGCCCGATCGATTTGGAGCGGATTTCGGCGTTGA
AGACTGTCTATACCTGGATGTCTATGTCCCAGCGTCTGTCAACCCAGGTG
ATGATGTGCCAGTCCTCACCTGGGTCTATGGTGGAGGTTACGCTATCGGT
TCTAAAGAGATGTGGGGAGACCCGGCCCGTTTGATTCAATCTGCCGATAA
ACCGATAATATATGTATCCATGAATTACAGGATTGGAGCCTTTGGATGGT
TGTCTCCGCCGAAAGCGGCAGACATCGATGCGAATATCGGTCTCCATGAC
GTCCTGGCTGCGATGGAATGGGTCAAAAAGTACATCTCCAAATTTGGGGG
TAACAAGGATAAGGTTACTGCAATGGGCGAGAGCGCGGGGGGTGGAATTA
TCATGCACGCTATTACGGGTTACGGAGGAAAAGGCAATAAGCTTCCATTT
CAGCAGGCAATCATCCAATCAGCCGGATTCGACCCCAAAAGAACGAACTA
CCCGGACCGGAATGCTCAATACGACGAGTTCAAGAAGAACGCAAACTGCG
CCACCCTGGAGTGTCTTCGTGGCGCACCCACCGAGGTACTTTTGAAGGCA
AATCGTGACACCATCAAGAAACTTGAAACGGGGGAAATAGGAAGTTTTGG
CCCAGCAGTTGATAAGGATCTTGTCCCGGATATTCCTATCAGACTCCTGG
CCCAAGGGAAGTACCACCATGAGCTCAGGAGCCTGATTTCGAGTGGCGTT
GGCTTTGAGAGCGGATTATTTTTCCCTACCCCA

Sequences in the Contig:

SY0AAA11YL24FM1 SY0AAA18YA10FM1 SY0AAA40YA22FM1
SY0AAA42YA18FM1 SY0AAA49YP04FM1