Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1104
Length(NT) : 848
Best Gene Model Blast : Link to GSTUMT00012089001 E-value : 0.0
Numbers of ESTs : 3

Blast Results:

Nr Definition: short-chain oxidoreductase, putative
Accession: ref|XP_001259014.1| Score: 362 E_value: 2e-46
KEGG Definition: hypothetical protein
Accession: ani:AN9378.2 Score: 313 E_value: 2e-37
KOG Definition:
Classification: [Secondary metabolites biosynthesis, transport and catabolism].
Kog Number: KOG1205 Score: 251 E_value: 2e-22
PFAM Definition: adh_short, short chain dehydrogenase. This family contains a wide variety of dehydrogenases..
Pfam Number: pfam00106 Score: 157 E_value: 1e-11
Swissprot: P37959|YUSZ_BACSU

Sequence:
>Contig1104
TTGGCCAACTTTTTTGTACAAAGTTGTCCCCCCAACTTTTTTGTACAAAG
TTGTCCCCATTTAATGCTCATAAACACGACTTCTACCACCTCTGTTTTTG
CTTGAGCCTTTCATTACTCTACAAAACAACCCTTCATTTCGAAATGGCCG
CTCCAAGAGTCTGGCTTGTCACCGGGACTTCCTCCGGTTTCGGAAACGAA
CTCGTCCACACCATCCTCAAAAACGGTCATAAAGTCGTCGCGGCGGGAAG
GAATACTTCGAGATTGACCTCTCTGAAGGAGGCCGGCGCTGCGACTACCA
AGATCGACCAGAACGAGCCCTTAGATATACTCAGGAAGCAGGTTGAGGAC
GCCATTACTATTTATGGACACATCGATGTTATCGTCTTGAACGCAGCTTA
TGTCACTACGGGAACTTTGGAGGAGCGAACGCCCGAAGAATCGCTCGCAC
AATACCATACAAACGTCTTCGGCATCCTAAACCTCTACCGCGCCATCCTT
CCGCACTTTCGAGTACGAAAGGCCGGTATTATTGCCACAGTCGGTAGCAT
GGGAGCTTCAATGACAGATCCTCTCATTGGTCTTTATCACTCTTCCAAAG
CCGCTACCTCTCCCTCACCCTCGACAATGAAGTAAAGCCCTTTGGCATAA
AAACTTGCCTGATCGAACCCGGATACTTCCGCACAAACCTCCTCTCCTCA
GGGACATCATTCCAGCTCCCAGAAACCAAGATCGAAGCCTACGCTGAGAT
CAACGAGAAAACAAAGACATTCCTCACCGAGCGGGACAGAAAACAAAGTG
GAGACCCCAAGAGGGGTGCTCAGGTCATCTTTGATGTCCTCACCAGCT

Sequences in the Contig:

SY0AAA10YG08FM1 SY0AAA42YA11FM1 SY0AAD59YM20FM1