Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1103
Length(NT) : 664
Best Gene Model Blast : Link to GSTUMT00001906001 E-value : 0.0
Numbers of ESTs : 4

Blast Results:

Nr Definition: conserved hypothetical protein
Accession: ref|XP_001543500.1| Score: 283 E_value: 9e-24
KEGG Definition: hypothetical protein
Accession: fgr:FG07125.1 Score: 257 E_value: 4e-21
KOG Definition: No Hit Found
PFAM Definition: No Hit Found
Swissprot: Q6NRS2|PQLC1_XENLA

Sequence:
>Contig1103
TTGGCTCCCTTCCCTGCCTTTTTTTCCCTTCGCCGCCCTACTCCCTTATT
AGCTTTACGACATCTTTTCTCTCCTCCCTCTTCATTGCCTCCGTGTTAAG
CTAGGTTTCGGGAACACACGCTCCTTTTTGCTCGAGTTTTATTTTATCAT
ACTTTAATTTTTTAATATCTTTTATCCTACCACGATTGTTCTCAACTACA
ACCTCCACACTTATTCAACATTTGACAGGAGGTGGGAAATAGTGAATAGA
AGGCAGCATGGGGTTTTTTGGAGTCTTGGTGTCTTATGTTGCGCCGTTGT
TTATCGTTACCAGCCCGCTTACGAGCTATGCGGATCAGATCCGGAATATA
CACGTAACAAAATCCTCCCGAGGCTTTTCACTGGACACACCCTTAATAAT
GCTCATAGCATCCATACTCCGCTGCTTCTACTGGCTCGGGGCGGATTTTG
AGACTAGTCTTTTGATACAAAGCATAATAATGATATTTGTCCAACTCCTC
CTCCTAAAAGTCGCCCTTGACTACCGCCCACCCTCCTACCCCCCACTCTC
GCCGCCAACTCCCACAGCTTCCCCAACTTCCACCTCCCACTCTCCGCCCT
TCCCACCATACCCACCAGCCCCGCGGCCCTACAATTTCTGGCAATGGCCC
ACTCAAAAACCGTA

Sequences in the Contig:

SY0AAA23YD06FM1 SY0AAA42YA07FM1 SY0AAB42YC05FM1
SY0AAD47YM02FM1