Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1101
Length(NT) : 718
Best Gene Model Blast : Link to GSTUMT00001366001 E-value : 0.0
Numbers of ESTs : 7

Blast Results:

Nr Definition: conserved hypothetical protein
Accession: ref|XP_001215590.1| Score: 289 E_value: 2e-24
KEGG Definition: ankyrin repeat
Accession: aor:AO090113000090 Score: 289 E_value: 1e-24
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig1101
TCCCTTCTTCCTCACTTCTTTGAAAATTTTCTTTACGAGTATCAAGGGCA
AATTCACTTTCTACGTCGACCGAGCGCAACGTCTTGCAGCACAAGTACTC
GAGTATCGATCGGCAAAGAACAGCAGATTTGGTTTCTACGTCCACCAGGC
GCAACATCTCCTAACATAGGAATCGATCGGTAAGATGAGCAACCAGGAAT
CGTGTGATTCTTCCGAGGATATTTCTTCACCCCAAAGCCATCATTCTAGC
TCGGCCGCCGTTTCCCCTAACGTTACGAGTCCCGCTATCGTCGCCAACTC
TGGCAACATCAACTCCTTCAACACCACCACAACCATCATCAACAAGTACT
ACGGCGGCAAGAACTCGTCCCAGTACTATGCCGAAATTTTGCAATGCCTA
TACACGTCCAAATACGGGGAGCACCGGGATCGGGTTCGGGTACCGGCGGA
GGGAACATGCAGATGGGTTATCGAACATCCCAAGTATAAGGGCTGGTTGG
AAAAGAAGACATCTGGTCTCCTTTGGCTATCGGCGGACCCTGGCTGCGGG
AAATCGGTCATCGCTTCGTTCCTCATAGACCACCTGACGATCCATACGGA
GGCCACAGTCTGCTATTTCTTTTTCAAGGACGACAACGAGGAACAGAGGA
GTGCAACCTTCGCTCTTTCCGCCATACTACATCAACTTTTCAAGCACAAA
ACGCGCCTCATTAAATTC

Sequences in the Contig:

SY0AAA41YP18FM1 SY0AAC2YC12FM1 SY0AAC2YP20FM1
SY0AAC33YG18FM1 SY0AAC34YP21FM1 SY0AAC40YK04FM1
SY0AAD6YL05FM1