Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1100
Length(NT) : 1227
Best Gene Model Blast : Link to GSTUMT00009102001 E-value : 0.0
Numbers of ESTs : 8

Blast Results:

Nr Definition: hypothetical protein CHGG_03878
Accession: ref|XP_001223092.1| Score: 857 E_value: 7e-90
KEGG Definition: hypothetical protein
Accession: ang:An12g07430 Score: 825 E_value: 2e-86
KOG Definition:
Classification: [Cytoskeleton].
Kog Number: KOG4462 Score: 120 E_value: 4e-07
PFAM Definition: Dioxygenase_C, Dioxygenase..
Pfam Number: pfam00775 Score: 135 E_value: 9e-09

Sequence:
>Contig1100
TTGGCCAACTTTTTTGTACAAAGTTGTCCCCCGGCTTTGCATCACTCTTT
ACCATACCTCCCCATTCAATCCTTTAAAACTCCAGAAACCCCTATCAAAA
TGGTCCACTTCTCAACAATCTTCACCGCCCTCACCCTCTTCTCCTCCGCC
GTGAGCGCCCATCCGGGGGAGCACAAAGAGGCAGAGGCCGCAACCCTTGC
CCGCCGCGCCGAATTCCTCTCCTACTCCAAGCGTTCCATAGCCGCTTGCA
AAGACAAGGTGAAAGCGAGGGACCTAGAGGCCCGCGCAATTGCCCGGCGT
AGCGCCCTCGCCGACGAGATTCGCCAGCAGCGCGCCATCGTCAGGAAGAG
AAGCGTCGAGAGCGTACTGAGCACTGACCATGAGACCAACCTCACGGGAG
TTACCTTGGATATTGATACTGGGGTATTGTTCTCCGGGGATGTTAAATGC
GTGCTTCAGCCGGAGGTTACGCAGGGCCCATACTATGTCGATGGAGAGCT
CGTCCGCCACGATGTCCGCGACGGCGAACCGGGCATAGACCTCTGGGCCG
ACATCCAAGTGGTCGATATAAACACCTGCGAGCCCATACCGAACCTGTAC
CTGGACTGGTGGCATGCAAACGCATCGGGCGTGTACAGCGGAGTCATAGC
GAGCGGTAATGGCGACTCCTCTGACGCCACTAACATCAACAAAACATTCA
CGCGCGGTCTTCGCCCCACCTCCCCCGACGGCGTCGCTCAAGTCCTCAGC
ATCTTCCCCGGCCACTACACCGGACGCACAACCCACGTGCACATCCTCGC
ACATGTGAATGCCACCCTCCACCGCAACCAGACCCTCATGGGAGGCCACA
ACGCGCACGTCGGACAATTCTTCTTCGACCAATCCCTCATCTCCGCCGTT
TCCGCTGTCGCCCCCTACAGCACGAACGAGCAGGAGGCCACGCCGAACGC
GAATGACACCATCCTGGCGGAGGAGGCGGACAGCATGGATCCCGTTATGG
AATACGCACTTTTAGGAGATGAGGTCGAAGATGGGATCTTGGCGTGGATC
ACCGTCGGCTTGGATGCTTCCGCTGATTATTCCGTCTCCAGCGCTGCGAC
GTGGACCGCACATGGGGGGGTTGCTAACGAGGGAGGGAACATAGGTGGCG
CGCCTGGCGGTTCTCCCAGCGGTTCCGCCGCTCCGTCGGGGGCTGCGCCT
AGTGGGTTGTAAGTCCTCGTTCGCTTA

Sequences in the Contig:

SY0AAA35YA15FM1 SY0AAA41YP08FM1 SY0AAB12YM19FM1
SY0AAB21YF01FM1 SY0AAB36YF17FM1 SY0AAB45YC19FM1
SY0AAB47YG02FM1 SY0AAB47YG10FM1