Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig11
Length(NT) : 1192
Best Gene Model Blast : Link to GSTUMT00009704001 E-value : 0.0
Numbers of ESTs : 4

Blast Results:

Nr Definition: hypothetical protein SS1G_07305
Accession: ref|XP_001591859.1| Score: 841 E_value: 1e-103
KEGG Definition: hypothetical protein
Accession: fgr:FG06680.1 Score: 823 E_value: 1e-100
KOG Definition: No Hit Found
PFAM Definition: SPB_interacting, Spindle pole body interacting protein. Yeast YOR129C has been shown to interact with the outer plaque of the spindle pole body..
Pfam Number: pfam08616 Score: 785 E_value: 3e-84

Sequence:
>Contig11
TTGGGGTCCTCGCTGCAAGTGATAAGAAAGAAATGTTTTCTGAGAAATTT
GACGAAATGGCAATGGCCTCGCCAAACGCCGTGGTTCACCAAATGAGGTC
GCCATCGGCCGCTGGCATGATCACAGCTAGTGACCAGGATGGTGATTTAA
GACCGACTACATATATCGATCTGGCACCTGGCAGGAACAAGATTGTGAAT
GGAAAAATCACTATTAATCGAGATAGCCATGAGTTTGAAACGAAAGTTGT
TTATAACGGCATACCTGTGCCTATAAGGGTTCCGGTAGCTGTTTTACCAG
AGACTGGTCGGTGATGTAAAGGAATCCCTCTTTCTCCTCCCTATCCTCTG
ATCGTTCATATCGTGTTTGATTGACATCTCTAAGTTCTCGTTGATACAAC
TCATTACCACATTTTCGAACCCTCATTCCCAGAACCCCCAGCCGTTCGCG
CTTCATCCGCACCTCACAACGAATGGCCCATACACACATCCCATAATGGT
TCTGGTTAATGGACTACTCACACAAAAGAGAATTGTGTTTCTTAGCCATG
GCCGCCCTTCCGGAGATGTTGCGGATCATGTGCTTGCCGCGTGTGCTTTG
GCATCGGGAGGAATTCTAAGAGGATTCACGCGTCATGCTTTCCCTTATAC
CGATCTCTCCAAAGTCGATGAATTACTACTGGTTACTGGTTTTATCGCTG
GTGTCACGAATCCAACGTTTGCCAATCATCCTGGTTGGTGGGATATTTTG
TGCAATATTGATACTGGCCGGGTGAAAATTTCTCCAGAAATTAAAATGTC
TGGGCAATCTGACGGTGCTGCTGTCTTTGGAAGTATGACCAACATGACAG
GAAATGTTGATACTGGCGACAATCAATTTATGGACGATATTTTGCACTGC
ATCTCGTCAAGGTTTGGCGAAAAGGCTGTAAGGGCTAGGTGGAGGGATTG
GGTCGTAAGATTTACACGGATGGCCGCTGCATTTGAGGAGATGGTTTACG
GAGCCAGCGCCTTATGGATCGGTCATGAAGAAAATCATGTCATCCGTGGT
CATGGATTTGTTTGGCCTGATGAGCAGACCAAAATTAGGGATTTAACTGC
CAACATGGCCAGGATCGAGGGGTGGCGAGGAAGTCGTAGTTACCATGCGT
ACGCCCAGGATGTTCAACAATTCTATATGGCGAAGCCGATTA

Sequences in the Contig:

SY0AAA10YE06FM1 SY0AAA44YC18FM1 SY0AAB57YN13FM1
SY0AAD19YO02FM1