Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1099
Length(NT) : 973
Best Gene Model Blast : Link to GSTUMT00007107001 E-value : 0.0
Numbers of ESTs : 2

Blast Results:

Nr Definition: hypothetical protein BC1G_15653
Accession: ref|XP_001545925.1| Score: 474 E_value: 1e-45
KEGG Definition: hypothetical protein
Accession: mgr:MGG_01518 Score: 468 E_value: 3e-45
KOG Definition: No Hit Found
PFAM Definition: Zn_clus, Fungal Zn(2)-Cys(6) binuclear cluster domain..
Pfam Number: pfam00172 Score: 116 E_value: 1e-06
Swissprot: P28349|NIT4_NEUCR

Sequence:
>Contig1099
TTGGGCCAAAACCTTCTACCAACCCGGGCGACGAAAGACGGTCACTACAG
CCTCTAGAGAGGCGGGTGAAGAGGAACTGCGTGGCAAACGCTTGTATGCC
GTGTCGGAAGCGGAGGTCCAAGTGCGATGGAAAGGTACCCTGTGCGTCAT
GTGTTTCTAGTAACCGCTCCCAGTGCGTGTATGATAAACAAAGTGACGGC
CGTCGAGCTGGCACTCTAAAACGACATATCAATGAGCTATCTGAGGACAA
CAACACCTTCAACTGCATCTTGGGAACGATAAGGAGTGCTCCAGATGAAT
ATGTCCAGCCTATCATCACCCGGCTAAGGTCAAACGAGGACTACACCGAC
ATTGCTAATTTCATACGAGATCACCCCTTCGAGACATCAGAACCTACAAC
GCCAACAACCTCAACACAACGGGCATCCTCCATAACCCTATCGGCGGACA
TAGAAATCTCGGAGACTTCGACAGATTACACGGAGTATGCTGAAGGGAGC
CAGTTTCTTGAAAATTCCTTCCGCGGGGCGAAGGGAGACATCGCGGGAGA
GTATTACTTGCTGAACGTGCAATCATGGACAAATGTGACGGGGGACACCG
AATTCATTGGACACCTCCTTTCTCTCTACTTCACATGGGAGCATACTTAC
TACGCTTTGTTTTCGGAAAAGATATTTCTCGAAGACCTTGTTTGTGGTAG
GAAAGAGTTTTGCAGCGAGCTTCTGGTGAACGCTGTCCTCTCACTGGCAT
GCACGTTTTCTGAAAGGACAGAGGCTCGGGCCAACCCGAGCGACCGGGGG
ACGCGGGGTGACCACTTTTTCGCTGAAGCACTACGGCTGCTCGATGGGGA
GAACATGATAGAAAATATCAGCGTTACGGTTATTCAAGCTCTCGCGGTAA
TGGGGATTCGTGAAGGGGGGTATTCACGGGATGTGAAGGGATTGATGTAC
TGTAGCCTGGCATTCCGTCTGGC

Sequences in the Contig:

SY0AAA41YO17FM1 SY0AAB39YC06FM1