Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1098
Length(NT) : 686
Best Gene Model Blast : Link to GSTUMT00001931001 E-value : 0.0
Numbers of ESTs : 2

Blast Results:

Nr Definition: hypothetical protein SNOG_03447
Accession: ref|XP_001794011.1| Score: 369 E_value: 1e-33
KEGG Definition: hypothetical protein
Accession: ang:An18g06740 Score: 338 E_value: 2e-30
KOG Definition:
Classification: [Signal transduction mechanisms, Lipid transport and metabolism].
Kog Number: KOG4136 Score: 348 E_value: 8e-34
PFAM Definition: Erv26, Transmembrane adaptor Erv26. Erv26 is an integral membrane protein that is packed into COPII vesicles and cycles between the ER and Golgi compartments. It directs pro-alkaline phosphatase into endoplasmic reticulum-derived COPII transport vesicles..
Pfam Number: pfam04148 Score: 355 E_value: 1e-34
Swissprot: P38869|SVP26_YEAST
Gene Ontology:
GO:0030134 = Cellular component: ER to Golgi transport vesicle
GO:0030176 = Cellular component: integral to endoplasmic reticulum membrane
GO:0030173 = Cellular component: integral to Golgi membrane
GO:0005515 = Molecular function: protein binding
GO:0006888 = Biological process: ER to Golgi vesicle-mediated transport
GO:0031505 = Biological process: fungal-type cell wall organization and biogenesis
GO:0006496 = Biological process: protein amino acid terminal N-glycosylation
GO:0045053 = Biological process: protein retention in Golgi

Sequence:
>Contig1098
TTGGGGCCCGCCTCCCTCCGCTATCATGAACAGAGGCTCAACTCCAAGCT
TCTCACCCATACTAGTACTCGCACGGACCAGCTGTTCACTTCATCTCTGA
CACACATCTCCCCCAAATCCTGTCTAATCGACCAGATTGCACAGACTCTT
GGAACCTCCCCCGCTCATCACCCGCTTGGGCTATCCGTTCGACACTCGCA
ACCATCATTATTCCTAAGCTTCGATCAGCATGTGGATTCTTCCGTTACTG
GGCTACACCGGTGTTATATTTGGCTTTTCGTTCCTGACGCTGGCTATCGC
TTCAGGGCTCTACTATCTCTCGGAGCTGGTAGAGGAACACACTGTCATCT
CACAAAAGATATTAATACGGCTTATTCAAGCTATAATAGCAGCTCATATT
CTATTGATTATATTCGATGGATTCCCCGTCATGTTGACGCTCTTTTCTGC
AGCCAGTCACGGCGTGTACTTGATGAATGTTACAAGGACATTCCCGATGG
TCAAACTTACGGATGGTGTCTTCATCCTATCTTGCTGTCTTGTGATTGGA
AATCATTTCCTTTGGTTCAATCATTTCTCAAACCCAGCCCTACCATCGGA
TCATCCCTTCAATCAACACCCGAATGGCCTGGGCAGAAACCTTTACGACT
ACTCGTCATCCGCTGACCCTAGTTTCCCCAGCCGTT

Sequences in the Contig:

SY0AAA41YO04FM1 SY0AAB58YF14FM1