Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1096
Length(NT) : 1132
Best Gene Model Blast : Link to GSTUMT00010311001 E-value : 0.0
Numbers of ESTs : 2

Blast Results:

Nr Definition: hypothetical protein BC1G_11523
Accession: ref|XP_001550315.1| Score: 246 E_value: 4e-19
KEGG Definition: NEMVEDRAFT_v1g199235; predicted protein
Accession: nve:NEMVE_v1g199235 Score: 154 E_value: 1e-08
KOG Definition: No Hit Found
PFAM Definition: No Hit Found
Swissprot: Q9JLC8|SACS_MOUSE

Sequence:
>Contig1096
ATCCTTGGCCTCCACAGAGAATGACAAATGGTGGACAATCGAGGGATTCA
CCGAAGAACAACTAATTCCGGCGGATTTAGCCGAGATGGCGGACTACCAC
AGACTTGAAGCCACATACGGACTTGCTGTCCCAGAACGCGCCCAACCCAC
TTTTTGTTTCATGCAACTTCCGCCACAAACAAAAGATCCCTTATCCCTCC
CAGTTGGCATCAATGCTAATATGGCATTGCAGAGTGACAGAAAAACTCCC
ATATCCGAAGAGAAAAATGGTCCTCTTGAGGGCTTAAAATGGAACAATTG
GATCTTCAAAGAGGGGATTGTGCCTCTCTACCTCCTATTCCTACGACACC
TTATGAAGCTCCATGGAACAGGTGGCTACCGTTTTTGGCCGGCACCGCCC
TCTGAGCTCAAAAACCCTGACCATGCATCCTTGACTATCTCCACTGAATT
TTGGAAAAAGGTGGGTAAAAGCTTATATGATCTATACCCTCAAGCACCCC
CTCCTCTCCTTACTCCGCGGAAAAGCCAATCACAGGCCACCGAAAATCTC
AGCATCAAGAGGGTTATTTTCGACTTTCTAAGCCCGGGGCAAAGCAAGTT
TATAGTCCCACTCCTCATGCAACTGGGTATTACAAATATAGTAACACTCC
CTCCTACCATTATGAAAGGATTGACAGGAGCTACCACAGACGAAGTATCG
CTATTATCAGTAACTCCGGCATATGTGCATGATATACTTCGCAACCCAAC
TCGATGCAAATTGCTTCAAGACCACTGGAAGAAGGACCCAGGGAACCTAG
CAAGAAACACCAGCATGTTACTATCCTTCCTCTTACAAGACACATCGGAG
GATTGCTTGACCGGGTGTTCACTTCTCCCCCTCGACGGTGGGTCCTGGGG
AACCTTCTCGCGAAAGTCAACTTCCCAGATCCAGTACTTCACCTCTAGAA
CTCCCCTGGAGCGTAGCATCCTGGAAATCACAGATGGGAGACTGGTTTCC
AAAGATCTTGAGTGCAATGTGATCAATGGATTGTTAGAAAAGATGAATAT
CTCTCTGCTAAGTTTCGATCATATACCCTCATTATGTCGGTTGGTGGAGT
CGAAAGATCCTGAATACCGAAAGACCTGGCTC

Sequences in the Contig:

SY0AAA41YN22FM1 SY0AAC27YD20FM1