Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1095
Length(NT) : 731
Best Gene Model Blast : Link to GSTUMT00001302001 E-value : 0.0
Numbers of ESTs : 4

Blast Results:

Nr Definition: hypothetical protein CC1G_09477
Accession: gb|EAU81233.1| Score: 797 E_value: 3e-83
KEGG Definition: beta-glucosidase, putative [EC:3.2.1.21]; K01188 beta-glucosidase
Accession: afm:AFUA_1G14710 Score: 748 E_value: 6e-78
KOG Definition:
Classification: [Carbohydrate transport and metabolism].
Kog Number: KOG0626 Score: 832 E_value: 6e-90
PFAM Definition: Glyco_hydro_1, Glycosyl hydrolase family 1..
Pfam Number: pfam00232 Score: 728 E_value: 8e-78
Swissprot: P49235|BGLC_MAIZE
Gene Ontology:
GO:0008422 = Molecular function: beta-glucosidase activity

Sequence:
>Contig1095
TTGGGAGAGACTTTCTTTGGGGATATGCTACTTCATCCGGACAAATCGAA
GGCTCACCAGAAGTCGATGGCCGTGGGCTGTCCATCTGGGACACCTTCTC
CCGCCAGGGCAACACAACAGAAGATGGAAGATCCAGCGACTTTGGGACAG
ATAGTTACATACGCTGGAAAGAGGATATTGCCCTCATGAAGAGCTACGGC
GTAAATTGTCACCGCTTCTCCATCTCCTGGTCCCGAGTAATCCCCTTGGG
CGGCCGCACCGACCCCATTAACCCGGCCGGGATACCCTTCTACAGAACCT
TCATCCAATCCCTCCTGGAAGCCGGCATCCAGCCCATGCCGACCCTGTTC
CACTGGGACCTTCCACAGGCCCTGCAAGACCGCTACAAAGGCTTCCTGAA
CAAGGAAGAGATAGTGGCCGACTTCACACACTACGCCCGCGTCGTCTTCG
AGGGACTAGGCGATCTGGTGAAAGTCTGGGTGACGATAAACGAGCCGAAC
GTATACGCTGCTCTCGGTCACTGCATCGGCGCGCATGCTCCGGGGAGGTC
GAGCGATCGGACGAAGAGCCCGGAGGGGGACAGTCTCGTCGAACCGTACA
TCGTCGGGCATAACCTCTTGCTGGCGCACGCCGCGGCGGTGAAAGTTTAC
AGGGAGGAGATCGCCCAGCAGGGCGGGAGTATCGGGTTGGTTATCAACGC
GAATTGGGCAGAGCCGTACGATCAGACGGAT

Sequences in the Contig:

SY0AAA12YG13FM1 SY0AAA37YI09FM1 SY0AAA41YN02FM1
SY0AAB42YA15FM1