Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1094
Length(NT) : 628
Best Gene Model Blast : Link to GSTUMT00006578001 E-value : 0.0
Numbers of ESTs : 2

Blast Results:

Nr Definition: hypothetical protein CIMG_07746
Accession: ref|XP_001240583.1| Score: 282 E_value: 1e-23
KEGG Definition: glycosyl hydrolase, family 47
Accession: aor:AO090038000608 Score: 273 E_value: 5e-23
KOG Definition:
Classification: [Carbohydrate transport and metabolism].
Kog Number: KOG2429 Score: 306 E_value: 4e-29
PFAM Definition: Glyco_hydro_47, Glycosyl hydrolase family 47. Members of this family are alpha-mannosidases that catalyse the hydrolysis of the terminal 1,2-linked alpha-D-mannose residues in the oligo-mannose oligosaccharide Man(9)(GlcNAc)(2)..
Pfam Number: pfam01532 Score: 229 E_value: 4e-20
Swissprot: P38888|YH04_YEAST
Gene Ontology:
GO:0005783 = Cellular component: endoplasmic reticulum
GO:0030246 = Molecular function: carbohydrate binding
GO:0005515 = Molecular function: protein binding
GO:0030433 = Biological process: ER-associated protein catabolic process

Sequence:
>Contig1094
TTGGATGATAGCCCATCTCCATGGCCTCTCATCCGCCCCTGAGAGCAAAA
CAATATCTCTCAATACTTATCCTCCTTCAATGTTTAACAGCAGTCCTGTG
CATGACCCCTTCCCGAAAACTCGCGCTCCGGGAAGAGGCTCGCGTGAGCT
TCCGCCACGGGTGGGAAAACTACATGATGCGGGCCTTTCCTCAAGATGAG
ATCAAGCCCCTGTCGTGCGCTCCTCATTACCGCGACCGGGATAACCCGAA
CAACATCGGCCGTAACGACGCAATGGGGGAGTTCTCCCTCACCGCTATCG
ACACGCTTAGCTCTCTTGCCCTGATGTCGGATAGTAGTGATCTTGATGCG
GAGAGGTTTTGGGAAACGGTTGGGGAGGTGGTGAGGATTTATTGGTACAA
TGAGCCGAAGGAGTGCGATATGGTTATCGAGAATTGTGGCGAGAAGACCA
GTTCTTGGGGCAGGTTCCATAATAGGAGTCGGGAGTCTCGGGGGTTTGAT
ATTGATGCTAAGGTTCAGGTGTTTGAAACAACCATCAGAATTTTGGGAGG
ATTACTGTCCGCTCACCTTTTCGCTACCCGGTCGTTGGCTTCATTACCTG
TTGGTGTACAGCCAAAGTATGAGTATAA

Sequences in the Contig:

SY0AAA41YL19FM1 SY0AAC44YE01FM1