Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1092
Length(NT) : 1271
Best Gene Model Blast : Link to GSTUMT00000794001 E-value : 0.0
Numbers of ESTs : 5

Blast Results:

Nr Definition: hypothetical protein BC1G_08693
Accession: ref|XP_001552215.1| Score: 1568 E_value: 1e-172
KEGG Definition: dynein heavy chain; K10413 dynein heavy chain 1, cytosolic
Accession: afm:AFUA_5G11810 Score: 1533 E_value: 1e-168
KOG Definition:
Classification: [Cytoskeleton].
Kog Number: KOG3595 Score: 133 E_value: 1e-08
PFAM Definition: Dynein_heavy, Dynein heavy chain. This family represents the C-terminal region of dynein heavy chain. The chain also contains ATPase activity and microtubule binding ability and acts as a motor for the movement of organelles and vesicles along microtubules. Dynein is also involved in cilia and flagella movement. The dynein subunit consists of at least two heavy chains and a number of intermediate and light chains (see pfam01221)..
Pfam Number: pfam03028 Score: 649 E_value: 2e-68
Swissprot: P78716|DYHC_FUSSO

Sequence:
>Contig1092
TTGGACAATCACCCTCCAGTATCAAGTAATTGCCCGTGCATGCAGTGCTG
TCTTTGCGGTCCTTGAACAACTCCATCACCTAAACCACTTCTACCAGTTC
TCGCTCCAGTATTTCCTCGGCATCTTCCATTCCGTCCTACACGACAGCAA
GCGTTTACAAGCTGAGACGGATTACAACGCTCGTATTCAAATAATTCTCC
ATGACCTTTTCGTTACTACTTATCAACGTACTGCCTTGGGATTGCTCCAG
AAAGACCGCGTGACCCTGGCAATGCTTCTGGCCCAGGCGTCTCCATCCAA
GATGGATAAATCCTTGATTGACCGCATCTTAGATGATGGCCTTCCGGGTG
TAGACGCTTCGACCGAGGTGGACAGGAGGGATGAAGTCATTCGGCGAGCT
TCGACACTTCCAATCTTCAAGAATTACATTGAGGATATCACCGCCGAAGG
GTGGGGGAAGTTCTTTCAGGAGGAGACTGCTGAGAGCTTTGTTCCTGTCG
TTTGGGACGGGAAGCTACCCGATCTTGACCAAGAGTTAAACAAACTTCTG
CTTGTCAAACTTGGCAGAGTGGACCGCTTTGTTCCATCTGCGGAGAAGTT
TGTAGGCGCTGTCTTTGGAAAGGACGTTCTGGATGCTGCTGGAGACCTCC
GCCAGGTTGTGGCTCAGGTATCTGCAACCACCCCCATTGCCCTCGCCTCC
TCACCTGGTTTCGATGCAAGTTACAAAGTGGATGGTCTGGTGGAGCAGCT
TAGGGTTAGCTGCACCAATATTGCCATGGGCTCAAACGAAGGTTTGGCAA
CTGCAGACAAGGCGGTCAGCAATGCCGCTTCGGCTGGGACTTGGGTCTTG
GTCAAGAACGTGCATCTTACTCCTGCATGGTTACAATCGTTAGAGAAGAG
GCTTGATGCATTACGACCCCATCCTAACTTCAGGCTGTTCCTCTCTATGG
AGTCTTCGCCTAAAATCCCCATCAATCTGCTACGTGCTTCACGCGTACTC
ATGTACGAACAACCTGCCGGGGTTCGTGCCAACATGAAGGATTCACTTTC
AACGCTGTCGACACGTCCAGCCAAACAACAGCCTACCGAGAAGGCAAGGG
TGTATCTTCTTCTCTCCTTCCTACACGCGGTTGTTCAGGAGAGACTACGC
TACGTTCCTAACCTAGGGTGGAAAGAATGGTGGGAGTTCAATGATAGTGA
TTATGAGTGCTCGGCCTATATTATCGATACTTGGATTGATCACGTTTCTG
GTGGCCGCACGAATGTTGCTC

Sequences in the Contig:

SY0AAA16YE17FM1 SY0AAA41YL14FM1 SY0AAA60YJ14FM1
SY0AAB13YO22FM1 SY0AAC29YK14FM1