Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1091
Length(NT) : 667
Best Gene Model Blast : Link to GSTUMT00003293001 E-value : 3e-08
Numbers of ESTs : 2

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig1091
TTGGACCGTCGACACACAGGAACCGATATTCTAGATCTCCAGGAGTAACC
TCAGCTTGGGATCGACGATAGCGACAGAGTAAAAAATGGGTTTCCGCCGC
AACGTCGCGGGGTAAAATCCTATCGGCAAGAAAAAGAAAAGAAGAGAAAA
GAAAAGAGTTGGGTCGGTGAATATTTTATTTTTCTAATAATTTTCATACT
ATTGCTCTTTCCTTCGGCGTACCGGTATCATATCATTCTACGGATCCGAT
CATACTATGATACTTTTTGAGTCACTCAAACTTTAACGAGCAAGGAGGGG
AGAGTTTTCCGGGTCGAGGGTTGAGGCTCTGCGGAAGCTATTTTAGGCAC
TGGCGGTCAGTTCCGTTTCGGGAATCCTAATCGACCCCCCTCAGATAAAC
TAGGGCATACCAGAGCTGAAGTTGAAGTGAATGAGCAAAGTCCCCGGGCA
GCACTCTTTGCCATCATTACCAACACCATCGTCGCCTTCCATCTTCAGAC
ACATTCTGAACTGCCGGTACCCTCAGCTTCTTATCTACGCCGCATTGAAC
TCGTGTACTCCTGTACGCCGCTTCACCTCCTCTATACCGTCATAACAACC
AAGTATAACCAGCCGACCAGCCAACCAACCTCCGATCCATGAATCCGATA
CCCAACAACGTGGACGA

Sequences in the Contig:

SY0AAA28YA22FM1 SY0AAA41YL06FM1