Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig109
Length(NT) : 893
Best Gene Model Blast : Link to GSTUMT00011071001 E-value : 0.0
Numbers of ESTs : 3

Blast Results:

Nr Definition: unnamed protein product
Accession: dbj|BAE57556.1| Score: 528 E_value: 6e-52
KEGG Definition: isochorismate synthase [EC:4.1.3.27]; K01657 anthranilate synthase component I
Accession: aor:AO090003000371 Score: 528 E_value: 3e-52
KOG Definition:
Classification: [Amino acid transport and metabolism].
Kog Number: KOG1223 Score: 288 E_value: 1e-26
PFAM Definition: Anth_synt_I_N, Anthranilate synthase component I, N terminal region. Anthranilate synthase (EC:4.1.3.27) catalyses the first step in the biosynthesis of tryptophan. Component I catalyses the formation of anthranilate using ammonia and chorismate. The catalytic site lies in the adjacent region, described in the chorismate binding enzyme family (pfam00425). This region is involved in feedback inhibition by tryptophan. This family also contains a region of Para-aminobenzoate synthase component I (EC 4.1.3.-)..
Pfam Number: pfam04715 Score: 232 E_value: 3e-20
Swissprot: P00899|TRPE_YEAST
Gene Ontology:
GO:0005950 = Cellular component: anthranilate synthase complex
GO:0004049 = Molecular function: anthranilate synthase activity
GO:0000162 = Biological process: tryptophan biosynthetic process

Sequence:
>Contig109
TTGGCGCTGGTATTTGGTAGTCTGGTTTTGCCATCTCAATTGACTTATTA
ACTACTAAATACTACAAGTGGTCACTTTCAACTCTCACCCTTGAGCTCCT
CCTTTATTTCCCTTCTTCCCTTTGACGTACTTTCTCCTCTAACCTTTTTT
TTTCACCTTCTCGCTTTTTTTTTTTTCTTTGGAAAAAAATAAAAAATGGT
TTCCAAACCTACTCGCATCCAACCGGACTTGCCCACTATTTTCGAACATG
TTCGTAAAGCAAGGGCCGCAGATTCTGCCACCTCTCCGAATATATACCCA
GTGTTTGCACAAATCCCTGCCGAATTCCTAAATCCCTCTAGTGCCTACCT
TAAGTTGAGCGCCAAGAGCAGCAGTAAATTATCATTCTTGTTCGAGAGCG
CTTCTAGCAGAGAGACAATTGGGCGCTTTAGTTTCTTGGGGTGCGATCCG
AGGGAGGTATTTAAGACAGGAACCGGCCACGGTCCCGAAGTTGACCCCCT
TGCCCAACTCGAGAAGGAGTTGGCTACGCACCGTGTTGGCAAGGTTCCTG
GATTAAATCTTCCGTCAATGTCGGGCGGAGCTGTTGGGTATGTGGCATAC
GATTGTGTTAAATATTTCGAACCACGGACTGCCAGGCCCTTGAAGGATGT
TGTTGGGACTCCAGAGTCGCTTTTTATGCTGTATGACACTCTGGTGGCGT
TCGACCATTTCTACATGACCATCAAGATTATTACGCACATTCGTATACCG
GAAGGCGACCTATCAGAGGAGGAGTTGGGGGAATTATACGGGAAAGCTCG
GGTCACTGTGTCGGAGGTTATCGAAACCTTACAGTCGGCGGATATTCCGC
TTCCTCCTCAGCCACCGATTCGGAAGAATCAACAGTATACATC

Sequences in the Contig:

SY0AAA14YD13FM1 SY0AAA45YJ01FM1 SY0AAB45YN19FM1