Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1089
Length(NT) : 1030
Best Gene Model Blast : Link to GSTUMT00005330001 E-value : 0.0
Numbers of ESTs : 7

Blast Results:

Nr Definition: hypothetical protein SS1G_13532
Accession: ref|XP_001585648.1| Score: 1201 E_value: 1e-130
KEGG Definition: hypothetical protein [EC:6.1.1.5]; K01870 isoleucyl-tRNA synthetase
Accession: ani:AN0705.2 Score: 1182 E_value: 1e-128
KOG Definition:
Classification: [Translation, ribosomal structure and biogenesis].
Kog Number: KOG0434 Score: 1381 E_value: 1e-153
PFAM Definition: tRNA-synt_1, tRNA synthetases class I (I, L, M and V). Other tRNA synthetase sub-families are too dissimilar to be included..
Pfam Number: pfam00133 Score: 816 E_value: 7e-88
Swissprot: O13651|SYIC_SCHPO
Gene Ontology:
GO:0005829 = Cellular component: cytosol
GO:0006428 = Biological process: isoleucyl-tRNA aminoacylation

Sequence:
>Contig1089
TTGGGACCCCTCCATCCCTCGAAGGATCTTTACTCGCTCATCTCCATCTT
GTCTAGCAGCTGTTGAGAGCACCATAGCTTTCTCCGATCTTTATAACTGC
CATTAGTTGACCGCAATGGATTTCCCAAAAGAAGAGGAGAGGATCCTTGA
GTTTTGGAGGGAGATTGATGCCTTCAGAACTTCCGTTAAGCTATCAGAAG
GAAGGCCACCCTACTCGTTTTACGATGGCCCTCCATTCTGTACTGGTCTT
CCACATTACGGACATCTCCTCGCGAGCACTATCAAAGATATCGTTCCTCG
ATACTGGCATATGAAAGGCCACTATGTCGAGCGGCGGTTTGGATGGGATA
CCCACGGCTTGCCAATTGAACACGAAATCGACAAAAGGCTTGGTATTACG
TCGAAAGAGGATGTCCTTAAAATGGGAATGGAAAAATACAACGAGGAGTG
CAAAGCTATCGTCATGAGATACTCTACCGAGTGGAGGCAAACCATTGACA
GGTTAGGTCGGTGGATTGATTTCGACAACGATTACAAGAGCATGTACCCA
ACATTTATGGAATCAATATGGTGGGTCTGTAAGCAACTCTTTGTGAAAGA
CCAGGTATATCTAGGATATAGGGTTATGCCATATTCTACCGCTTGCACAA
CACCCCTTTCGAATTTCGAAGCTCAGCAGAACTACAAAGATGTCCAGGAC
CCTGCGGTTGTAGTTACTTTCCCGCTTTTGGATGACCCGACTACAGAGCT
ACTTGCCTGGACGACGACTCCTTGGACTCTCCCTTCACATACCGGAATTG
CGGTTCATCCGGATTTCGAGTACATCAAGATTAGTGATCGAGCTTCTGGC
AGAAATTACATCCTTCTCGAGTCGTGTCTTAAGACATTATACGGAGAGAA
GGGGTTGAAAAAGGCGAAATACACCATCTTGGAGAAGATCAAAGGGAAGG
ACATGCTAGGGTGGAAATATGAACCTCTGTTTGACTACTTTTACGAACAA
TTCAAGGATTACGGATTCAAGGTTTTGAAC

Sequences in the Contig:

SY0AAA38YO14FM1 SY0AAA41YK12FM1 SY0AAA41YN01FM1
SY0AAA53YN22FM1 SY0AAB11YK12FM1 SY0AAC4YJ04FM1
SY0AAD48YJ04FM1