Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1088
Length(NT) : 1200
Best Gene Model Blast : Link to GSTUMT00001230001 E-value : 0.0
Numbers of ESTs : 5

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: hypothetical protein
Accession: mgr:MGG_03989 Score: 131 E_value: 5e-06
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig1088
TTGGCCCCACACATGGAAGCGAAATTTCTCTAACTTTACTGTAAACTTTT
GTTTCTTGTTACTTCATTCCACCCCCCCTCCCTCCCCAGTCGAACTCTCG
GGGCTTGTTTTGCTATCTACTCATACCCGCGTACCCTTCAAGGCCGAGAA
AAGAAAAGAATTCAAGGATAATTCATCCCTGCTCTAGGCTTTGTTTAGGC
TCCATAACCGTGCTATCGGCATCCCCTGAGACAAGGGAAAAAGAAAAAGA
AAGAAGAGAAGAGACCTTTCTCACTCCCTCCATCCAGTACCGGCACTTTT
TCTAGTCTGCCGTATTCTACGCTATCTACCCTATCCTATTTTCTTGGAAG
TCGATATCGGATTCCTCCAGTGTTCGTCGGCTCCACGTTGCAACTGTGAC
ATCTCTCCCCACTGGCCCAGTGCCACCGCAACCAAATCTTCCGATATCCC
GTTTTCCCCCGATCTTCGTCTCGACAACCGCCGCGCTAGACTACCTACTC
CGCTCCTCCGCCTGCCTTTCTCTCGCTGCTGCAACCCCTCCACCAGACCC
ACCCTACCTTCGCAACTCGGCGCCTTTCATTTACTGCACTCACTCCCGGA
CTTGATACCACTGTGCCACTCTCTCTGAGCTCAACCGGGAACGACATCGA
GTACAGGGTGTATTTCCGGACACTTGAGAAAAAAATTTTAAAAAAAATAA
TTAAAAAAAAAAAAATACTGTGGGAGCTAGGAAGGGAGGAAGGAAAGCAC
GGAAGGAAGGATAGAAGGAAGTCAGACAGTCGAGTCAAGGAGTCATGCCC
ACCAACAGACCTTTTCTAGCGAATCTGTTGGTAGCGTTCCGAGCTCATAG
CGCTACGGCCAAGGGTTCTTCCAACAATCCATCATCGTCCTCGCCATCAT
CAAAACCCTCTGCGGGACCAAAGACCCAATCGGCCCCAGCAAGCAGTTCA
ACGACCGCCCCCTCGTCAACTGCTGCCATGGCTACCGCCGCTGTCCACAC
GAATAGTAGTCAACAGCAACAACCCACTAACTTCACCTCTTCAAGACAAC
GAAGGAGTTCATCAAGCTCAACGGAGGGTTTTGTGGAGCCTCCTTCGGGC
GAGAAGTGGTGGATAGGTGGCAGGAATTCGGATGGCCAGGAACGGTTTTA
CCGATTACAGCCAGTGAGGAGGCAGAGATCTTGTGACCGATTATCGCTGG

Sequences in the Contig:

SY0AAA41YJ23FM1 SY0AAB37YM06FM1 SY0AAB42YD02FM1
SY0AAC14YB12FM1 SY0AAD44YH11FM1