Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1087
Length(NT) : 789
Best Gene Model Blast : Link to GSTUMT00000220001 E-value : 0.0
Numbers of ESTs : 2

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition:
Classification: [Signal transduction mechanisms, Intracellular trafficking, secretion, and vesicular transport].
Kog Number: KOG1029 Score: 166 E_value: 1e-12
PFAM Definition: Caldesmon, Caldesmon..
Pfam Number: pfam02029 Score: 149 E_value: 1e-10

Sequence:
>Contig1087
TTGGGCAAGTACGAGATCGAAATTGAGAGGGAACGGAGGGTGAGGAGGGA
TGCCATGGTTCAGGAATGGATGCAGCTACGTGAGGAGCAGGAGAGTGCTA
TGCACAACATCAGGGCATATAGAATAATGCGGGAGCAGAAGGAGGCTCAG
AGGAAAGAGGCCGAACGGAAGGAGATTGAGAGAAGAGAGGTTGAGAGAAG
AGAAGCTGAAGAGAAAGAGATACAGAGAAGAGAGGTTGAAAGAAGAGTAG
CTGAAGAGAAAGAGATGCAGAGAAGAGAGGAAGAAAGGAGAGAGAAACTT
CGGCTGGAGAACCAAAGAACTATCGAGCTGGAGATAGAACGTGGGAGGAT
TCTCCAAGAGATCAAGAAGAGGGTCAGGACGGAGTCAACAGCTCCTTTGA
GAGAAGATAAGGAGGAGTTGGATTGGTCCGGCACGGATACCCCGGCCGCC
GAAGATACCTACAAGACCCCACAATACCCCCCAGCGCAAAAATACTTTGT
CTTGACGCGAAATCCATCCACCAACGACTTCAACTTTGCGCCCCTTCCTC
TCGCCCTATCTCCCATCTCACCCGAACAGACCACCCCGATAAAAGTGTTC
GAGAACATGCAGTCCCCCGAAAAGTTTATAGGTTATTGGGATGTAGTTCA
GAGGTTGGGCTTTGAGATCGTGGCGGGAGAGAGGGAGTGTGTTATTGTTC
GCGCCCCCATCGAGGATGCAGATGGGAAAATGCAGAGCATGCTGCAGGAG
ATCGAAGGGATGCGGAAGCTCCAAACTAAACCCGCCCTC

Sequences in the Contig:

SY0AAA41YJ18FM1 SY0AAC54YB12FM1