Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1086
Length(NT) : 654
Best Gene Model Blast : Link to GSTUMT00002329001 E-value : 0.0
Numbers of ESTs : 2

Blast Results:

Nr Definition: conserved hypothetical protein
Accession: ref|XP_001541718.1| Score: 414 E_value: 5e-39
KEGG Definition: hypothetical protein
Accession: ani:AN6291.2 Score: 359 E_value: 7e-33
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig1086
TTGGTAACGACTAAAGCATCGCCGGTACATATGACGCCTCTTTCAGATGC
CACGTTAATTGTGTCGACAATGGATCGACAGATTCACAAATTTGATTTAA
ATGCGGGGAAAAGTGTTCATGGGTTTCGGTGTACAGATGAATCGGGTGAT
GCGGTTGTGATGGACGCTATAACGGTTGGAAAGGACAAGGGATACCCGAG
ATCTAGAATTCTTGCGGGTATATCGACAACGGATAAGAGTATACGCCTTT
ACGATTTAGCTGGAAATCTCATTGATAAAGAATGGGGACATACTGAGGGA
GTCAGTGATGTTGCATTATTGGAGAGGGGCCCACGGAAAGGGGAAGAGAC
GGGTCAAACAATAGTTATCAGTACGGGCACAGACGGCACGATCATGATAT
GGGAATTTAATCCCAAAGCCCAGGAACTGGAACCCGCTACTAGCGCAGTT
GTTGCTTGCCCAGACTCTGTGGATGGCGGTTCTGCCAAGAAAGAGATGAC
CGCGACAAAGCCGCCCCTACGAAGGGTACTGAGTCGGAGTGAGCTGATGG
ATTTTTCGCCCAAAACGGCTCCAGTGACGCCGAATCCTAGGCCTTTATCT
GTCCATGTCCCATCCTCTCCTCCCCGAACGCTGAGACGGAAGACATCGGC
TTAC

Sequences in the Contig:

SY0AAA41YJ05FM1 SY0AAA41YO16FM1