Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1085
Length(NT) : 1751
Best Gene Model Blast : Link to GSTUMT00009762001 E-value : 0.0
Numbers of ESTs : 9

Blast Results:

Nr Definition: RNA polymerase II largest subunit
Accession: gb|ABI49122.1| Score: 2200 E_value: 0.0
KEGG Definition: DNA-dependent RNA polymerase II largest subunit, putative [EC:2.7.7.6]; K03006 DNA-directed RNA polymerase II subunit A
Accession: afm:AFUA_1G14680 Score: 2151 E_value: 0.0
KOG Definition:
Classification: [Transcription].
Kog Number: KOG0260 Score: 1874 E_value: 0.0
PFAM Definition: RNA_pol_Rpb1_6, RNA polymerase Rpb1, domain 6. RNA polymerases catalyse the DNA dependent polymerisation of RNA. Prokaryotes contain a single RNA polymerase compared to three in eukaryotes (not including mitochondrial. and chloroplast polymerases). This domain, domain 6, represents a mobile module of the RNA polymerase. Domain 6 forms part of the shelf module. This family appears to be specific to the largest subunit of RNA polymerase II..
Pfam Number: pfam04992 Score: 552 E_value: 6e-57
Swissprot: Q75A34|RPB1_ASHGO

Sequence:
>Contig1085
TTGGGTCGGTTACCTCCCCTTACAACGCCGATTTCGACGGCGATGAAATG
AATCTTCATGTTCCCCAATCCGAAGAAACACGTGCTGAAGTTAGCCAACT
CTGTATGGTGCCTTTGAATGTCGTGTCGCCTCAGAAGAATGGACCTCTCA
TGGGCATTGTCCAAGACACTCTCTGCGGTATCTACAAAATGTGCCGAAGA
GATGTATTTCTCAATCGTGAACAAGTTATGAATATTCTCATGTGGGTACC
CAATTGGGATGGAACAATACCTACGCCTGCAATCTTGAAACCTCGACCTC
GTTGGACTGGGAAGCAAATGATTAGTTTAGTTATTCCTCCTGGGATAAAT
AAGGTTGATCTCGCAGGGGGGAAGTGGTCTCCGTTAAACGACGAGGGCTT
ACTAGTTCATGGCGGTGAGCTGATGTTTGGGCTTCTTAACAAAAAGGCGG
TCGGACAGTCTCATTTGAGTTTGATTCATATCATATACAACGAGAAGGGT
GCCTACCGATGCTTAGAATTCTTCAATGGTTGTCAGACAATTGTCAATTA
CTGGCTGCTCCATAACGGCTTTAGTATTGGTATTGGGGATACCATTCCGG
ATAAGTTAACTATCGAGAAGATTGCAGCGACTGTCAAAGAGAAAAAAGAC
GAGGTCAATGCAGTTACTGATAAAGCTCAGCGCAACGAGCTCGAACCCCT
ACCGGGAATGAATATCCGTGATACTTTCGAGAACTTGGTCCAGAAATCGC
TTAACTCTGCCCGCGATAAGGCAGGTTCTGACACTGAGAAGAGTTTGAAG
GACAGCAACAATGCAATTCAGATGGCTCGATCTGGTTCAAAGGGTTCTAA
CATCAACATCTCTCAGATGACAGCGGTCGTAGGCCAACAATCGGTTGAGG
GGAAGCGTATTCCCTTCGGGTTCAAATACCGCACCTTGCCCCATTTCACA
AAAGATGATTATAGTCCTGAATCCCGCGGATTCGTGGAGAATTCCTATCT
TCGTGGCCTTACCCCTCAAGAGTTCTTTTTCCATGCCATGGCTGGTAGAG
AAGGTTTGATTGATACAGCTGTCAAGACTGCCGAGACTGGTTACATTCAG
AGACGGTTGGTTAAAGCGTTGGAAGACGTCATGGCCAAATATGACGGTAC
CGTGAGAAATTCCCTTGGGGATATCATCCAGTTCATTTATGGTGAAGATG
GCCTTGACGGAATGTACATCGAACCACAAACCGTCGACATTATCGCATGT
TCGGACGCGGAGTTTGAAGATAAGGTTAGAGTTGATGTTATGGATCCAGT
GAGGTCGATCCCCCTCGAGTTTCTCGAGGTTGCACAGGACATTGCTGGTG
ATGTAGAGGTGCAGGCTGCTTTGGACGAAGAATTTGAGCAGCTCCAGAAG
GATCGGGCATTCTTGAGGTCACTTCAGAAAGACAGCGTCGACGAGAAGCT
ACAATTACCCATCAATATCCTTCGCATCTTGGAGAACGCCCGCACTATTT
TCCGTATCAAGCATCGCGCTCGGAGTAATCTTCATCCTCTTGAAGTCACT
GAAAAAGTCAAAGAACTTGTGAAGAAGCTCGTTGTTGTTCGTGGCAATGA
TCCTCATTCTATCGAGGCTCAGCAAAATGCCACTGGGCTTTTCATGTGCC
ATCTTCGATCTCGCCTTGCGTTCAGGAGGTTGGTCATTGAGTGTAATCTC
TCTAAAGTTGCGTTTGATTGGGTCCTCGGGGAAATTGAGTCTCGGTTCGC
T

Sequences in the Contig:

SY0AAA36YN16FM1 SY0AAA41YI02FM1 SY0AAB28YJ08FM1
SY0AAB54YC07FM1 SY0AAC24YN07FM1 SY0AAC31YH09FM1
SY0AAC37YP18FM1 SY0AAD38YN08FM1 SY0AAD41YN14FM1