Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1084
Length(NT) : 1168
Best Gene Model Blast : Link to GSTUMT00008397001 E-value : 0.0
Numbers of ESTs : 16

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig1084
TTGGGAGATTCAAAGCACCATCGTATACGCTATAATTGCCCATTGCTATC
ATACCAATCCAGATTCAGATTCAATCATGAGCGAATTCGCACAAACACCA
AAACCAACTACTACACCTCCGCCACCACCGCCTCCAAACATGACTTCTTC
TCATGATACACCAAGCAATATCTTCTTCCCCCCCTACCTCCTCCAAGACG
TCTTTGAGCATCTGGACCCTCTGGACCTGGTCACTTGTAAGCGTGTTTGC
ACACTCTGGTACTCCATAATCTGGGGCCGCCGCCGGCTGCGACAAAAGCT
GTTCCTGCCCCAAGTCACCGCAGAGGAAGCCCCAACAAGCCACCTCGTCA
ATTCCCCGGATGAAGTCTACGACCTCCACCCCATTTTCAATCAAATCCAT
TTCGACGCATCGCTGGACCCCGCATCAGCCACCTTTGGCCGACAAAAATG
CGCACTCTTGAAGGAATCCAAGGTGAAGGACCATTACGCTACCTACCCGG
CGACTACAAGGGTTGAGTTGGACGTTATACACTTTCACCCACACCTGGTG
GTGGAGAATGAGACGGGGGTGACGGTTTGGGACGTTATGGAGGCGTTGGC
GAAATACAAAGCCGAGCCCACACACTTCACTTTCCAATCGTTCTTCCAAT
CAGACATTTGCAGGAAGCGTGGGTACGACCAGCACCGGCGCATGCATCGC
AGGGATTTATTGGGAATAGATAGCGTGTTCATCACCTTCAACGATAGAGA
CCCCAAAGACGGACGGGTATTCGTTAGCGATTCGTTCGAGTCGCGGGAGG
GTGTCGCCGTGGGCAAGAAGTATAGGTTTTGGAGCGCTTTTGCTTTTTGC
GAATTTCCGCCGAGGACCGAGTGAAGGTGGGTGGGTGGTGATGTGAGTTT
GGAGTGGGGGGGGGAGCGATTGCGACCGTGATGGTGAGGTGATGATGATG
ACTGTGGCGCTTTCTCCTCTTTTCTTTTCTCTTCTTTGGGTGGCTTGTGA
TGTTTTCTCTCCCGTCGTTTCGAATTCTTTTCTTCTTTTCTTTTTCGAGT
TTGGTGTGGGTATTTGTCGATTTGTGACTTGCGTTCGCTTATCGAGGAGT
TCTTTGGGATTTTTGATTCGATATGCTCTTGTAATCTACCAATATTGGAC
TCTTTAGTACTTTCTCGT

Sequences in the Contig:

SY0AAA13YC21FM1 SY0AAA1YL09FM1 SY0AAA28YJ07FM1
SY0AAA30YD22FM1 SY0AAA30YD22RM1 SY0AAA41YH15FM1
SY0AAA60YJ23FM1 SY0AAA62YM07FM1 SY0AAA9YA11FM1
SY0AAB16YK01FM1 SY0AAB33YL15FM1 SY0AAB38YA08FM1
SY0AAB3YF18FM1 SY0AAB40YJ02FM1 SY0AAD45YK07FM1
SY0AAD7YK05FM1