Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1083
Length(NT) : 1323
Best Gene Model Blast : Link to GSTUMT00000218001 E-value : 0.0
Numbers of ESTs : 18

Blast Results:

Nr Definition: hypothetical protein SNOG_01992
Accession: ref|XP_001792613.1| Score: 263 E_value: 6e-21
KEGG Definition: hypothetical protein
Accession: ani:AN0903.2 Score: 241 E_value: 1e-18
KOG Definition:
Classification: [Inorganic ion transport and metabolism, Amino acid transport and metabolism, Signal transduction mechanisms].
Kog Number: KOG1053 Score: 110 E_value: 8e-06
PFAM Definition: No Hit Found

Sequence:
>Contig1083
TTGGACCCCTAATACACAGCCCCAATCGGTGCTCGAGTAAAATACTGTAC
GAGTCCTAGTACACCTGCTGTTCCTCTTCGAAAACGCAAAAACTTACCAA
AACTTCCCACACTTTTCCACCGAGAGACGAGACCGAGTATGAGTATGAGC
GCCCTTCGTCGCCTGTCATATGCCATGGGTGGAGGTGGAGGTGGAGGTGG
GGATGGGGGTGCACATGACGAGGAAACCCCGCGCCGTCATCATCATCATC
ACCATCTGCACCATCACCATCATGATAAGAAAGATTACACCATTAGTCCA
ACCGGCGGGAATGTACCGGTTAGGATCCCTTCGGAGGAAGAAGCCCCGCA
CCGCCATCGACACCGCAGGAGGAGGGCTTCCACCACCCCTGCTTCCCAGG
AAAAAGGTCGCCGATCGCCGCCGAGGGTCATAGACCCCGAGTTTGAACCA
AAGAAATCCCACCCACATAAACGGGTTGCCGTGACTTTTGATAGCCCAAC
TAGTAGTGCCTCATCAATCACTTCATCCGGTGGGATAGAGATTCAAGGAA
ATCGACGGAATCATGGGGAAAGTCCCCCTCTCACGCCGCTTATAAAGACC
ACCCCCCCAACCCCCTCGCCCCTTGAGCGAGCTCGCAGGACAAATTCACA
ACGCGTTTATCGGCCGCCGCCCCCGTATCCCGTTACTCCCCGTCGAGACG
AGACGGAATACATCGCTTTTTCCCCTGCCAATAACATGTCGATCCCGGAT
GGACCACAGGGGCGCCATAGCGACTCTGTTGCCCCGGGAAAGTTCGCGCC
CCACCCAGGAGCGGTAGAGATTGGGAGCAGCGATTCCATCGTTCAGGAGC
CAAAATGGACGGATGGTTCCAGTTCTAGTGCACCGTCCCCAAGCCACCGT
CCGAGCGAGAGGAAAGCACCCAAACCCGCTCGTCGCCCTGGTCTGAGCAA
GCATAGGGGTTCAATACGCGAGAATCAGTATGACTTCCTCAAAACCTTCG
ACACAGTTTTCGTAGTCGACGACTCGGCATCCATGGCAGGCGAGCGTTGG
GATCAGCTCGGCCAAGCCCTCGAAACAATCGCCACCATCGCCACCAAGTA
CGATTCCGATGGCATAGACATCCACTTTCTCAACTCCCCCCAGTACGACC
ACGAGCATGTCACCTCCCCAGCCTCCGTGCGAGACCTCTTCGTCAGTGTT
CAGCCCGCAGGAATAACACCAACCGGCGCTTGTCTAGACCGCATCCTGCG
AGAGTACCTGGACAAGTACGCGGATGCGAAAGCCGCCTATACCCCATCCA
CCAGCCCCGGCCCACACCCAACA

Sequences in the Contig:

SY0AAA14YC06FM1 SY0AAA14YF15FM1 SY0AAA19YE19FM1
SY0AAA2YG24FM1 SY0AAA33YP18FM1 SY0AAA41YH12FM1
SY0AAB31YK11FM1 SY0AAB37YC12FM1 SY0AAB43YF09FM1
SY0AAB46YK05FM1 SY0AAB55YJ14FM1 SY0AAB60YJ24FM1
SY0AAC31YF08FM1 SY0AAC42YK02FM1 SY0AAC50YM09FM1
SY0AAC60YE17FM1 SY0AAD40YI09FM1 SY0AAD50YH08FM1