Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1081
Length(NT) : 954
Best Gene Model Blast : Link to GSTUMT00004503001 E-value : 0.0
Numbers of ESTs : 24

Blast Results:

Nr Definition: urate oxydase UaZ
Accession: ref|XP_755385.1| Score: 822 E_value: 5e-86
KEGG Definition: urate oxydase UaZ [EC:1.7.3.3]; K00365 urate oxidase
Accession: afm:AFUA_2G10520 Score: 822 E_value: 3e-86
KOG Definition:
Classification: [Secondary metabolites biosynthesis, transport and catabolism].
Kog Number: KOG1599 Score: 473 E_value: 4e-48
PFAM Definition: Uricase, Uricase..
Pfam Number: pfam01014 Score: 366 E_value: 9e-36
Swissprot: Q00511|URIC_ASPFL

Sequence:
>Contig1081
TTGGGTACCCCAGCACTGGAATATTATGGTTGCGCCTCTTCCCTTTTTCC
CGCTCACCCCGCTGATCCCGGGTCCCGTTTCTTTGCCGCTGGAAACACCC
AAGAAGATAACTCAGATAAGGTATAAAGTACCTTGCTGCCCCCCTCCAGC
TTAACTCTTCACTGTCAATCTGCAACCTCCGTCTACCTACTCAATACAGT
TGCTATCCTTCTCCTTTGCTTCCAGCCATAACTCTCCACTCTATAAAGTC
AGAGATTGCATCATAAACATGTCTGAGTTGTCTGCAGCTCGATATGGGAA
GGATAACATTCGTCTCTGCAAAGTTCACCGTGATGAAGGTACAAACATTC
ATACTGTCACTGAAATGACCGTCTGTGTACTTGTGGAGGGAGATATCAAC
TCCTCGTACACACGCGCAGACAATAGCGTCGTCGTAGCTACAGACTCAAT
GAAGAACACTGTTTACTTGCTCGCCAAGCAGTACCCAGTAACTCCACCAG
AACTTTTTGGCTCAATTCTTGCCTCCCACTTTATCGAACTATATCCCCAT
ATTCACGTTACCCGTGTAAAGGTTGTCACGCACCGATGGACGCGTATGAC
AATCGACGGCGAGCCGCACCCGCACTCGTTCCTTCGGGACGGCGCAGAGA
CTCGCAACGCTGAGGTTGTTTGCAAGCGAGGGACAGGTATTTTCGTGAAG
TCAGGGATCCAGGGATTGCTGGTCCTCAAAAGCACCGGTTCGGCTTTCTA
CGGCTTCATTAAGAACGATTATACCTCTTTGGGTGAAACCTCTGATCGCA
TTCTCAGCACAGAGGTGGATGCCAATTGGGAATGGGGCTTATTCAACACA
TTGGGTGACGTAGAGAGAAATATCCCTCTTTTCGACATGGGTTGGGAATC
CGCACGAAATATCACTCTTCAAACATTCGCAAAAGACAACAGCGTGAGCG
TCCA

Sequences in the Contig:

SY0AAA26YN06FM1 SY0AAA31YL10FM1 SY0AAA32YE06FM1
SY0AAA37YF04FM1 SY0AAA41YH01FM1 SY0AAA41YO10FM1
SY0AAA42YF17FM1 SY0AAA53YN02FM1 SY0AAA7YC13FM1
SY0AAB24YJ21FM1 SY0AAB25YN12FM1 SY0AAB31YP16FM1
SY0AAB44YC03FM1 SY0AAB54YN11FM1 SY0AAB55YJ04FM1
SY0AAC40YD13FM1 SY0AAC49YB22FM1 SY0AAC52YM19FM1
SY0AAC53YF19FM1 SY0AAD12YJ16FM1 SY0AAD40YE02FM1
SY0AAD42YK05FM1 SY0AAD59YI05FM1 SY0AAD63YN01FM1