Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1080
Length(NT) : 620
Best Gene Model Blast : Link to GSTUMT00008712001 E-value : 0.0
Numbers of ESTs : 2

Blast Results:

Nr Definition: hypothetical protein CIMG_07667
Accession: ref|XP_001240504.1| Score: 448 E_value: 5e-43
KEGG Definition: predicted protein
Accession: aor:AO090005001425 Score: 432 E_value: 2e-41
KOG Definition: No Hit Found
PFAM Definition: DUF1708, Domain of unknown function (DUF1708). This is a yeast domain of unknown function..
Pfam Number: pfam08101 Score: 125 E_value: 5e-08

Sequence:
>Contig1080
TTGGCTATTGAGTAGTGAACTCACCCCATCTCATCTCATCTCCTTTTTGG
TACTTTTTCCATCAACATCCCCGGGCCCTGCAAGACCCCCTACATCACGC
TCGCTCGCTTGCGCACGTCGTAGATAAGCGCACTTAAGACCCGACTGCAG
CTTTTTTTTTGTCGCGTCAGGGGAAGGAAAAAAAAAAAAGCCAGCTGTGC
CTTCTCAACACATCCCAATGCCCACCTTTCTGAATAAGGTCTTTAAACGG
GACCACGCCGGATCTTCAAAGAAGATCGAACCCAGCGCGCCTCCACCGCC
CCAAGAGGTTAAACACCAGGACGCGTGGTTACGGACAGAAGTCACTCCTG
AGCAAGTTCAGGAGCTGTTGAGGGGATGCACTCAGGAGATCAAGTCAAGA
GGCCTGTCAACACCTTTTCTGCTATTGCCTTTTCGACCAAACTCGGATGC
CAGCGCCGCCAGAACCTTTATCCGAAATTTCTTCGATCCGGTAACAGGGC
CGCTTCGCGGGCCCCACCTCCAGCAAGAGTTACGATTGACTGAACCTGTG
GTTTTATGCAGCACTCTGAAGTGGTGTTGGAGTAGGTTACCCGGTGGCGT
GGTAACCTGGGATTTGTATG

Sequences in the Contig:

SY0AAA41YG19FM1 SY0AAC59YJ19FM1