Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig108
Length(NT) : 749
Best Gene Model Blast : Link to GSTUMT00009247001 E-value : 6e-84
Numbers of ESTs : 21

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig108
TTGGCCAACTTTTTTGTACAAAGTTGTCCCCAACGGACTTTGGTGAAGGA
CAGGAAAAAAAATACCAGCTATCAAGAGAGAAAAAGCGAGCATACCTCCT
CCTCATACCGGCAATATCTCATTGCGCGCACAGCTTATCTGCCCATTCTC
GACCTTACACAAAATCGAGCAGCTCCTCCATTCACCTTACAAAATTTCCC
GGTGGCGAAAGGTGGCAAACCTCCCTTTCTATTTTACTATTTAATACCGA
TATCCGCATATCCTTCTTAAAAAGTCCTCGTTCCATCATCCTTCCAAACT
CCTTCACCGGCTCAATCCAGAAGCTCAAAGCTTAGCCGTGCCCTTTTCCT
GCATACTGTCTCTCGGCAAACATCCCTAAAGCCATCGCTCAAGTAGGAGC
CATCCATTATCCACACCCGCACTATCAGGTCCCTCCAGCGAAGCAAAAGC
TCATCTATTGAACTTCCCATCGCAACCCCAACAGCACACACAAAAATGAA
TTGGACCTGCTGCCAATGTGGCCGAAACTGCCATTGCACTACATGCGACT
GCGGTCATAGTCTCTGCTTGAGCTGTGTGTATTCTCGCCGACCAAAGCCT
AAAGCATCGGGCACCCGCCGCTCACGATTGGCCTCAATTCTCCGGAGGTG
AAGCTAAGGCTACCATCACAACTTGACGACAACCGATGTTTCAATTGCCA
AGGATAAAAATGGAGAGAATTGGGCTATTGTACATACACAAGGGGTCGG

Sequences in the Contig:

SY0AAA11YB04FM1 SY0AAA14YD08FM1 SY0AAA29YF13FM1
SY0AAA35YD19FM1 SY0AAA40YN10FM1 SY0AAA4YM21FM1
SY0AAA52YP16FM1 SY0AAA59YE09FM1 SY0AAA60YE05FM1
SY0AAB18YF22FM1 SY0AAB19YI16FM1 SY0AAB40YD04FM1
SY0AAB40YN10FM1 SY0AAB50YK01FM1 SY0AAB53YK20FM1
SY0AAB54YG02FM1 SY0AAB54YK02FM1 SY0AAB57YB08FM1
SY0AAB60YG10FM1 SY0AAD1YJ01FM1 SY0AAD38YJ23FM1