Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1079
Length(NT) : 1545
Best Gene Model Blast : Link to GSTUMT00004908001 E-value : 0.0
Numbers of ESTs : 8

Blast Results:

Nr Definition: hypothetical protein SNOG_14118
Accession: ref|XP_001804315.1| Score: 540 E_value: 5e-53
KEGG Definition: hypothetical protein
Accession: ani:AN7134.2 Score: 526 E_value: 1e-51
KOG Definition:
Classification: [Posttranslational modification, protein turnover, chaperones, General function prediction only].
Kog Number: KOG2182 Score: 383 E_value: 2e-37
PFAM Definition: Peptidase_S28, Serine carboxypeptidase S28. These serine proteases include several eukaryotic enzymes such as lysosomal Pro-X carboxypeptidase, dipeptidyl-peptidase II, and thymus-specific serine peptidase..
Pfam Number: pfam05577 Score: 428 E_value: 1e-42
Swissprot: P90893|YM9I_CAEEL

Sequence:
>Contig1079
TTGGGGGGACAACTTTGTACAAAAAAGTTGGGAAATCTAACTTTCTTACC
ACAACCCGACACAGTGCATCGCTCAAGATGTTCTTCCCTTTATTTCTTAT
GTTGGCCCTGGTTGCAACGCAGGCGGTGGCATCTCTTCTCCGACCAAATA
GCGTTAGGCTATCAGATTATCACCTTACAGAAATTATAAACCGTGATATA
TTAAAGCCGGCACTGGAGAATGACGACCTTCCAACTGCCCCTAAGCGCTA
CGTTGAGCTGCCTCTTAATCATGGTGATCCAAAGTCCCCAAAGTTCAAGA
ACAGGTATTGGGTGGATGATACCTATTATTCCCCTGGGGGGCCCATTTTC
TTTGTCGATAATGGGGAAGCGGATGCGGACGGCATGGAAGAGTATCTGAG
GAAGGGAGCCACGGGATCATTAGCAAAAGAGTTCAATGGTCTCCTGATAT
TGTGGGAGCATCGATTCTATGGTACCTCAATGCCGGACATGACAAATGCC
ATGCGGTTCACATCCGATAATTTCGGGGCCTATCTAAAATATCACACGAT
CGAGCAGGCATTGGAGGACGTGGTAGTGTTCGCAAAGCAATTCACCTTCA
ACAATAAAACAGTCTCTCCCGGGGAGGTTCCTTGGGTATACCTAGGTGGT
TCCTACCCCGGCGCACGGTCAGCTTGGATGCGGATCCGCAATCCTGACAT
CTTCCATGTGAGTCTGGCTTCATCCGCTGTGGTGCAACTTCAGAAGAATA
TGTGGCAGTATTACCGCGTAATTGAAGAAACCCTGGACAAAACCGGCTAC
GCCAACTGTTCCAGGGACATCCGCAACATAACGAAATGGGTTGACAACGC
TTTCGACGATCAAAATGGACCGGCTGTCGACCAATTCCTCGAAAAAATCA
CCGGCCCGGAGAATTCGGACTTGTGGAATTTCTTCCACTTTGATGACTCC
TCAGATCCGGGAGAGATATGGGACAACAGGCGGATGAATGTGAAGGCCGC
AATCGGAGTCGTGTACCGTGACTTTCAGTATGTGGGGATGAATGGGATTC
TAAGGACCTTCTGCGATGGTTTGCAGTCCAATAGTGGCGATTCGGCGGGG
GTGGGAGCGGACTTCCGGAACGCTAGGGGAATATTTGAGACGCATAATAC
TAGTGCTGCCATCGATATCTATACGAGTGTTTTGGCAGCACTCTGGCCGA
AGGTTCTCAAACCAACAGATTACCCGGCAGACGGAGTCAAGATGGATCAA
GTTTATAACGTGAACTGCGCAAGGAATCAGGGCCTCTGCAAGCAGATAGT
TACAAAGTGGTCCTGGATTTACCAGACTTGCATTGAATTTGGCGCCTACC
AGACTGCGAATATTTCCCGTCCAACAAACCTCCTCCCCAAATTCGAAACC
ATCGAAAACGAGCTCAGGGATTGTAAAGGCTGGTTTGGCAACGCGGTAGC
AGGTGGCCCCAATCTGGATCCCATCAACAAAAAATATGGCGGCTGGAACA
TGAACCCATCGAATGTCTTCTGGACTGATGGTGAAATCGACCCCT

Sequences in the Contig:

SY0AAA15YB02FM1 SY0AAA41YG15FM1 SY0AAA45YJ03FM1
SY0AAA55YA09FM1 SY0AAA56YF12FM1 SY0AAA7YE17FM1
SY0AAB13YL22FM1 SY0AAB38YL18FM1