Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1078
Length(NT) : 1403
Best Gene Model Blast : Link to GSTUMT00006110001 E-value : 0.0
Numbers of ESTs : 20

Blast Results:

Nr Definition: unnamed protein product
Accession: dbj|BAE60845.1| Score: 1481 E_value: 1e-162
KEGG Definition: 3-oxoacyl CoA thiolase
Accession: aor:AO090012000715 Score: 1481 E_value: 1e-162
KOG Definition:
Classification: [Lipid transport and metabolism].
Kog Number: KOG1389 Score: 1171 E_value: 1e-129
PFAM Definition: Thiolase_N, Thiolase, N-terminal domain. Thiolase is reported to be structurally related to beta-ketoacyl synthase (pfam00109), and also chalcone synthase..
Pfam Number: pfam00108 Score: 645 E_value: 6e-68
Swissprot: Q05493|THIK_YARLI
Gene Ontology:
GO:0003988 = Molecular function: acetyl-CoA C-acyltransferase activity

Sequence:
>Contig1078
TTGGCTCAAACCCGCGTCTTTGATCTCTCCATAAACCGCAACTCATTCCA
ATTCAATAAATCCTAAACTCGTCCTACCTGCAGTTATGGCGTCCGAAAGA
CTCAACTCCATCCTCAACCACTTCAAGATGCCCTCTGGTTTGGCTGCTGT
TACTTCAAGAAACCCAGACGATATCGTGGTAACCTTTGCCGCGAGGACGC
CTTTAACAAAGGCGTTCAAGGGCGGGTTGAAGGACACCCCAGTAGATTAC
CTCCTAATGCAACTCTTCCAACACGTCCGCGAGAAATCAAGGATCGACCC
CAAGTTAGTGGAAGATATTTCCGTCGGGAATGTCAACGAACCGCACATAG
CATACAAAGCCCGCGCAGCGGTACTCGCAGCCGGATTCCCGAATTCCACC
GCCGTGTCCTCGGTGAACCGCTTCTGTTCTAGCGGTATGATGGCTATCCA
AGGAATAGCGAACCAAATCAGCAGCGGCTCTATCGAGATTGGTTTGGCAG
CAGGTGTAGAAAGCATGTCTCGGACACCCGATCTGGCGCCCGAGTTGGCG
CCGGAGATTCTATCAGCAAGCCAAGAGGCGGGTGACTGTTTACAGCCTAT
GGGCCAGACAAGCGAGAACGTGGGCAAAGACTTCAACGTGCCCCGAGAAG
CGCAAGACCAATTCGCGGCGAAGAGCTACCAGAAGGCAGAACACGCGCAG
AAGTCCGGATGGTTCGATGAGGAGATCGTCCCAATCACTACCAAAGTCAA
GGATCCCAAGAGCGGCGAGGTTAAGCAGGTTACTGTTACCGCCGATGATG
GTATCCGCTACGGAACAACATTTGAATCCCTCTCCAAGATTCGCCCTGCA
TTCCCTAAGTGGGGCGATAAATCCACCGGTGGAAATTCCTCGCAAGTGAC
TGATGGTGGTGCAGCGGTGCTCCTCATGAAGCGCAGCACAGCAGAGAAGT
TGGGACAGCCCATTCTTGCTAAATTCTGTGGAAGCACTGTTGTTGGACTC
GCACCCAGGATCATGGGTATCGGACCAAGTCTTGCTATCCCCAAGCTCCT
TGGGAAGTTTGGATTGACGAAAGATGACATTGACATCTTTGAGATCAATG
AGGCGTTTGCTAGTATGGCGGTGTATTGTCTGCGGGAGTTGGGCCTGGAG
GAGGAGAAAGTTAACCCTCGGGGCGGAGCTATTGCCCTCGGTCATCCATT
GGGCGCTACAGGTGCCAGGCAGGCCGCTACTGGCCTGGCAGAGATGAGGA
GACAGAGGAAGAAGGTTCTTGTTACTAGCATGTGCGTTGGGACCGGTCAG
GGAATGGCCGCGTTGTGGGTTAATGAAGTTTTGTAAATTACGGATTGATT
TAGGCAAATTATGTGTTTGAAAGCGCTATGAACGCTTACTCTGTTTATAC
CTC

Sequences in the Contig:

SY0AAA41YF20FM1 SY0AAA59YF05FM1 SY0AAB40YH23FM1
SY0AAB41YC09FM1 SY0AAC17YE24FM1 SY0AAC25YM23FM1
SY0AAC41YH05FM1 SY0AAC44YO14FM1 SY0AAC45YK06FM1
SY0AAC8YL07FM1 SY0AAD14YO24FM1 SY0AAD19YK16FM1
SY0AAD21YO19FM1 SY0AAD23YG10FM1 SY0AAD3YB22FM1
SY0AAD41YG17FM1 SY0AAD42YH12FM1 SY0AAD43YJ06FM1
SY0AAD46YM23FM1 SY0AAD58YH02FM1