Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1077
Length(NT) : 1665
Best Gene Model Blast : Link to GSTUMT00005671001 E-value : 0.0
Numbers of ESTs : 17

Blast Results:

Nr Definition: hypothetical protein SS1G_12653
Accession: ref|XP_001586666.1| Score: 384 E_value: 7e-35
KEGG Definition: predicted protein
Accession: aor:AO090009000407 Score: 380 E_value: 1e-34
KOG Definition:
Classification: [Transcription].
Kog Number: KOG0260 Score: 123 E_value: 3e-07
PFAM Definition: No Hit Found
Swissprot: Q750U1|STB3_ASHGO

Sequence:
>Contig1077
TTGGAATAACCTCTTCATTCCCTATCATTTGGTACGGGTAGCTCTTTTTG
GTTTCACCCTTCTCATTTTCCTTTTCTTGGTCCCCTTCTTTCTGTCCTTT
TCTCTTCTTCTTCCTTTCCTTTCCCTTTCCTTTCCTTGTCACTTTGTTTT
TTCTTGAGCATAACAACGTTGGAACTTTTTCTATCACTCTAGCCATTATC
CTTTATTAAGAACTCCCAAATCCTTTCTTCTTCTCCAAGAAACTCTACCA
CCCAGCATGGCCACCATCACCACCACCACTGCAACCTCCATGTCCGTCGC
AATCCCGACCTCCCGCCCCCACCGCGGCGGCAAAGCAACGGTGTCGGACA
ACAACGCGTTCACGCTCCCTGAGCCCTACTCCCACTTTCCCACGCCGCCG
AACTCCATTTCACCGTCCCTGCCACCGGTGCCGAATCCCGTGACTGCATC
CGCGGACTCGGACATTGACGTTCCCGACATTATTACCACGACTAGCACCA
CTCCTGTTCACCACCAGCTCAAGGCAGCACCTGGAACCTCGTTGCTTGCT
GAAACAACGGGAGCAATCACTTCGTCTCTTCTAGCAAAATACCACCTCCC
GGAGATCCTGCTCAAGCACGGCCCACTGGCCATCCGGCACTTAACAGCAC
ATCTGATCTCCGCGATACCGGGTTTCTCTAGTATTCCGCCGGCAAAGCAG
CGACGACTGGTGGTTGGTGCATTGGAAGGGCGTGGTGGAGTGAGCGGGAG
CGAGGGCGAGGCCGGCGGTGTCAATGGTGACGTCGTGTTTGACAAAGTAG
GCTGGGGACGCTGGGATGCGCGCGTAAAGTCCGATCCACCGAGGTCTCAT
CGGGGGATATCACCAGCAACTTCTGATCACTCCAGCTTCGTGAAGACGAA
GGCCGGAATTGTGGGCAGGAGTTACACTGGCGAGTCGGGCATTTTCGTGC
AATCGGAGGAGGAGGGGGATGAGTCTATGGATTCAGAGGGTGTGGAGGGA
GAAGAGGAGGAGGAGGACGGGGTTGATAGAATGTCATTGGATGAATCCTC
GTCTTCTGAAGACGAGGAGGACGAGGACGATGGAGACGTCACGGATGAGG
AAGACTGGGCTCAAATGGGCGCGGCCATGCTCAGGAATCAAGTTGGGTCG
CCGATTTCTCCCACTGGTGGCGGGTTCGATAACCTTTCAACGGCATGGGG
AGCTTCGGTCAGGGCTAGGGAGGAACGGGAGGCTGTAGAAGCTCTTGTTA
AACTCAGTTCTGTCTGACTCGTTTTGGTTCGACGTAGTTTGTTTCCTTTC
CTTTGTTTCCTCCCTTTCTTTTCCTTTTTTATACTATCTATTCGGCGTAC
GGGTTTCTGTTCTGTTCGGAGAAATTAAATACACGGCTGTGGGGATTGGG
TATTTTTATTATTTCCTCTTTTTGGCGGGAGGGGAACTGTTTTGGGCGTT
TTTCTTATATCTCTCCTCTCCTCATCATCATTCTCATCATCTGCATAAAC
GTTTAACTACCCTTTCCCTTCTTCCACCGTTTTTGGTTGGTCTCTGTTTA
ATCATTGTCGCATTACATTTCTTTTCCATGTTCCTTTTCCACTCCCATTC
CCTCCCCTTCTTCCATTCCATCCCATTCCAACTCTACCCTATCCTCACAA
AGAGCAAACGAAACG

Sequences in the Contig:

SY0AAA31YJ10FM1 SY0AAA35YG18FM1 SY0AAA41YF10FM1
SY0AAA41YK08FM1 SY0AAA41YM22FM1 SY0AAA49YJ07FM1
SY0AAB28YA24FM1 SY0AAB36YC15FM1 SY0AAB45YL20FM1
SY0AAB49YC16FM1 SY0AAB53YH18FM1 SY0AAB56YH07FM1
SY0AAB56YN17FM1 SY0AAB57YL13FM1 SY0AAC24YF11FM1
SY0AAC5YE08FM1 SY0AAD7YO06FM1