Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1076
Length(NT) : 2064
Best Gene Model Blast : Link to GSTUMT00009055001 E-value : 0.0
Numbers of ESTs : 16

Blast Results:

Nr Definition: hypothetical protein BC1G_06474
Accession: ref|XP_001554826.1| Score: 1566 E_value: 1e-172
KEGG Definition: hypothetical protein
Accession: ang:An16g02520 Score: 1503 E_value: 1e-165
KOG Definition:
Classification: [Amino acid transport and metabolism].
Kog Number: KOG2616 Score: 578 E_value: 6e-60
PFAM Definition: PALP, Pyridoxal-phosphate dependent enzyme. Members of this family are all pyridoxal-phosphate dependent enzymes. This family includes: serine dehydratase EC:4.2.1.13 P20132, threonine dehydratase EC:4.2.1.16, tryptophan synthase beta chain EC:4.2.1.20, threonine synthase EC:4.2.99.2, cysteine synthase EC:4.2.99.8 P11096, cystathionine beta-synthase EC:4.2.1.22, 1-aminocyclopropane-1-carboxylate deaminase EC:4.1.99.4..
Pfam Number: pfam00291 Score: 296 E_value: 3e-27
Swissprot: Q42598|THRC_SCHPO
Gene Ontology:
GO:0005829 = Cellular component: cytosol
GO:0005634 = Cellular component: nucleus

Sequence:
>Contig1076
TTGGGAATTGGATCCCTTTTTTTCTTCCCCCACCCGTATTGCACACCAAC
CAACCAAGACGAAGGAAGGTTTCTCATTTAACACCTTCCCAAACGACGAG
CTCGATTCTTAACTACTTCCCCCTTTTTTTTTTCCTTCCTGCTCTGAGGA
AATTTAACGATCATGGCTTCACCCACCGCCTCGCAAAGGTACTTGAGTAC
CCGTGGCGGGTCCTACGGCTTCACCTTTGAGGCCGCCGTCCTCAAAGGCC
TCGCCAGCGACAACGGCCTCTTCATCCCAGAGGCAATTCCATCCCCACCC
ACGAACTGGCAAAAAACCTGGAAGACCCTCTCATTCCAAGACCTAGCTTA
CGAGGTCCTCTCACTCTACATTTCCCCGGACGAGATCCCCTCCTCAGACC
TACGGGAGCTGGTCACACGCTCGTATTCCACCTTCCGCCACGAGGACATC
ACGCCACTCAATACCATCCTCCCGGATGCAAACCTGCACGTCCTAGAGCT
GTTCCATGGCCCCACGTTTGCGTTTAAAGACGTTGCATTGCAATTCGTCG
GGAACCTGTTTGAGTATTTCCTCGTTAGGAAGAATAAGGATGTGAAAGAG
GGGGAGAAGAGGCACCACTTGACAGTGATCGGCGCTACGAGTGGAGATAC
CGGATCCGCCGCTATCTATGGCCTTCGCGGGAAGAGGGACGTATCAGTAT
TCATCCTCCACCCGAAGGGTCGTGTGAGCCCGATCCAGGAAGCGCAGATG
ACGACAGTGCTAGACAAGAACGTGCACAACCTCAGCGTCGTCGGAACTTT
CGATGACTGCCAAGATGTGGTAAAAGCACTCTTCTCGCATCCCGAATTGT
CAAAGTCCCACAACCTGGGCGCAGTCAATAGCATCAATTGGGCCAGGATC
CTCGCTCAGATCGTCTACTACTTCTATTCCTACTTCACCTTGCTCAGGCG
TCTGCCGGTAGGAAGTGTACCCATCTTTCGCTACGTCGTGCCAACGGGAA
ACTTCGGTGACGTGTTGGCGGGTTACTATGCTAAAAAGATGGGCCTACCA
ATCGATAAGCTCGTCATTGCGACAAATGAGAACGACATCCTGGATCGCTT
CTTCAGAACAAGCCGCTACGAAAAGCGTCCTGTGTCCCCAGAGGAGGGTG
AAGGTGGCCCAGCAGTAGGCGGGGTTAAAGCAACCCTTTCCCCAGCAATG
GACATCCTCATATCCTCTAACTTCGAGCGTCTACTCTGGTACCTAGCCTA
CGAGAACGAAATCCCCAACGCTACCAACGAAGACCAGAAACGTGCCCGGG
CCGGCAGCGTCCTGAACGAGTGGATGACCTCCTTAAAGAACACTGGCACT
ACCGTGGTCTCCGAAGACGTGCTTAACATTGCAAAGAGGGACTTCACTTC
CGAGCGTGTTAGCGATAACCAGACTGTCGAGACTATACGGCATATGTTTA
ATACCCCGCCTTCTGCATCTTACATTCTTGATCCGCATTCGGCCGTTGGA
GTCGCCGCTTCCTTGAGACTTATTAAGGCTTCGCAGGCTGCTGGCGAAGA
AAACGTCCACCATATCTCATTGTCAACCGCACATCCGGCAAAGTTCAATC
ATGCAGTGGATCTAGCGCTCACAGGGATTAGTGGTGGCGAGGAGGTCGGG
GACTATGACTTCGAGAAGATGGTCAGGCCACAAGAGTTCCTTGGCTTAGA
GACTAGGGAGAAGAGGGTTCGCGAGGTGGAGAGGGCGGATGTCGAGCTTG
TTAGACAGGTTGTTGTCGAAGTGCTAGAGGAAGAAGAGGTTGAGAGGTAG
TTTTTTCCCCCCCCCCCTCCCCACCCACGGCTCCCCACTGAACCGGGCCG
GGGCTGTCCACGCAATTCCATAAGATAAAAACCCCCTTGACGAGCGTCTT
GCTTTTGGGGAACGAGGGTGCGATTTTCGTTATGGCGCCGACCGCCCATA
TGCTCCAACTACCATCATCAGACAGATAGAAGATATATAACTTTTACCAC
ATGATATATATTAAATGAAAGAAAAAAGGAAAAAGAGTCAATGAAAAGAA
ACACAATCGCCTTT

Sequences in the Contig:

SY0AAA41YF09FM1 SY0AAA41YM18FM1 SY0AAC16YF05FM1
SY0AAC18YF12FM1 SY0AAC20YA21FM1 SY0AAC20YA21RM1
SY0AAC23YO21FM1 SY0AAC26YN18RM1 SY0AAC2YG18FM1
SY0AAC46YC02FM1 SY0AAC46YK03FM1 SY0AAC47YF05FM1
SY0AAC54YK18FM1 SY0AAC9YB12FM1 SY0AAD26YH11FM1
SY0AAD59YM19FM1