Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1075
Length(NT) : 704
Best Gene Model Blast : Link to GSTUMT00010465001 E-value : 0.0
Numbers of ESTs : 2

Blast Results:

Nr Definition: conserved hypothetical protein
Accession: ref|XP_748200.1| Score: 436 E_value: 7e-54
KEGG Definition: conserved hypothetical protein
Accession: afm:AFUA_5G01420 Score: 436 E_value: 3e-54
KOG Definition: No Hit Found
PFAM Definition: DUF1994, Domain of unknown function (DUF1994). This family of proteins are functionally uncharacterised..
Pfam Number: pfam09352 Score: 385 E_value: 4e-38

Sequence:
>Contig1075
TTGGACTCGCGATCTCACCAGGAAGACATCAAAATGAAGCTTTCGGCCAT
TGCTCTCTTTATTTCTGCCGCCACGGCGACCCCGGTCAACGAGCTCGTAA
AGAGGACTCCTCCGAATATTCCTAGCGCAGCGAGCGCGATAAGTATGCTT
GCTTCTCTCACTGTAAGGACTTCGGACCCATCGGGCTACGACAGAAATCT
GTTCCCGCACTGGATCACAATCAGTGGTTCTTGCAACACTCGTGAGACTG
TCCTGGCGCGCGACGGAACCAACGTCATCCAGGCCAGTGACTGGCTCAGC
AGTAAGCGGAAGTTGGTACAGCCCTTACGACGGTGCAACTTGGACTGCTG
CCTCTGATGTTGACATCGATCACGTCATTCCTCTTTCCGATGCCTGGAAA
TCAGGGGCCAATACCTGGGTGAGGTCCAATCCTTTATGATTTTCATTGCC
CTACCTCAGTAACTTCCACACATTAAAGTCCCCAATCCTAATCATCTCCA
AGACTACCGCATTGCGCCAACAATTCGCCAACGACCTAACGAATCCCCAA
CTCATCGCTGTGACGGACAACGTTAACCAAGCCAAGGGCGACAAATCCCC
TGATTTGTGGAAGCCTCCTCTAACCTCCTACTACTGCACTTATGCCAAAA
TGTGGGTCAAGGTCAAGAGTGCATGGTCACTCTCTGTCAAGTCTGCCGAG
AAAT

Sequences in the Contig:

SY0AAA41YF06FM1 SY0AAB17YP24FM1