Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1074
Length(NT) : 772
Best Gene Model Blast : Link to GSTUMT00010769001 E-value : 1e-124
Numbers of ESTs : 11

Blast Results:

Nr Definition: hypothetical protein An15g06080
Accession: ref|XP_001397137.1| Score: 184 E_value: 4e-12
KEGG Definition: hypothetical protein
Accession: ang:An15g06080 Score: 184 E_value: 2e-12
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig1074
TTGGAGCAAAGTTTCCATTATCGATACGATCCGGTGTTGTCCTGTTGTCT
GTTTGTCTGTTTGTTATAATCTAATCATCGCCACCCTCCTTCATCCGTCT
TTCCTACTCCCTTCATCTCTCCTTGCCTTGCATCGTGTCGTCCTTAAACC
CACAAACTCCAACGCCGGCAAAAGAAAACAAACCCACACAACACATTCAC
TTTTCAACCCACTCCTCGGACAGCTTTTCCTGGCGATAGCATCAACCTTC
CCCTAATAACATATCAAATACCACCCCTACTACGCAATGTCTTTCGGTTA
CGCCTACTTACCGCATCCCGGACAAACCTCCTCGGGCAACCGCTCTCCAG
TCTCTACTTTTATTGAAAAGTTTGAGGCGGGAAGGTCTTTTGAGATGGCG
GATGATTTTGCTTTCATCCCGGAGCTGTGTACGGAGGAAGAACGCCAGAT
GATGGACTACTCGTCTTCAGATCGTTCCTCAACCTCAAGCGGTTCTCCTC
AATCATCACCATTACAGCATCAGGTTCAACCCTCGACAGCCTATCCCCAC
GCTGCCACCTATGCAAACATGTTCCACAACATGCATCTCAAATATCAGCA
GCCCCCCCCCTCTATGCCTCCAAAACAACGTTTTGCTATCCCCATCGTGA
ACCCTAATACTGGGCTGCGCGTTGCTTCTCCTCCACTAGCGTCACCAAAC
AGGAATCCTTACCCCAGCTCTAGCCTCGCCAGGAGGTGGTGAGATCGCTC
GCGTCCTTGACAAACCAACCTT

Sequences in the Contig:

SY0AAA22YH03FM1 SY0AAA41YE11FM1 SY0AAA44YK14FM1
SY0AAA45YL21FM1 SY0AAB18YL20FM1 SY0AAB2YK02FM1
SY0AAB34YE11FM1 SY0AAB51YB01FM1 SY0AAB52YB05FM1
SY0AAD46YD04FM1 SY0AAD51YP24FM1