Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1073
Length(NT) : 1078
Best Gene Model Blast : Link to GSTUMT00004253001 E-value : 0.0
Numbers of ESTs : 9

Blast Results:

Nr Definition: conserved hypothetical protein
Accession: ref|XP_001542748.1| Score: 784 E_value: 2e-81
KEGG Definition: nucleoside-diphosphate-sugar epimerase, putative
Accession: afm:AFUA_5G07170 Score: 717 E_value: 5e-74
KOG Definition:
Classification: [Defense mechanisms].
Kog Number: KOG1502 Score: 143 E_value: 9e-10
PFAM Definition: Epimerase, NAD dependent epimerase/dehydratase family. This family of proteins utilise NAD as a cofactor. The proteins in this family use nucleotide-sugar substrates for a variety of chemical reactions..
Pfam Number: pfam01370 Score: 139 E_value: 2e-09
Swissprot: Q12177|YL056_YEAST
Gene Ontology:
GO:0009636 = Biological process: response to toxin

Sequence:
>Contig1073
TTGGCCCACTCAATCTTCCCTCATCACCAACGACCCTTCTTTATCGCCGA
ATTACCGTAAAAAAATCCCGAGGTTATCTCCTTCAGATCAATAATTCATA
AAATGCCTCCTAAGCTCTTTGTAACCGGAGCTTCGGGCTACATTGGTGGC
ACCGCCCTCGACGTCATCATCAATGCCCATCCTGAGTACGAGATCACCGC
TCTTGTCCGCAGCCCAGAAAAAGCCACTGCGGTAACGAGAAAGTACCCTA
ACGTCAAGACCGTTTCCGGAGAGCTCGACTCTGGCTCCTTAATCGAGGAG
GAGTCCTCAAAGGCAGACATCGTCCTCCACTTTGCAGATTGCGATCACGT
CCCCTCGGCAAAGTCAATTGTTGCTGGTCTCGAAAAGCGCGCGACGCCTT
CATACCTCATCCACACCTCCGGATCCGCAATTCTCCCCGACATTAATCTT
GCTTCAGAATTCGGCAAAGCCGCTTCAGACAAGATCTACGATGACATTGA
CAATGTCCAAGAAATCACCTCACTCCCAGAGTCTGGCCATCTACACAGAG
ATGTTGATTCGATTGTGATTGGAGCAAATTCTAACACTATCAAGACTGCT
ATTGTTTGCCCACCCACTATTTACGGTCCTGGTTCCGGTCCGGGAAACAT
TCGTAGCAACCAAGTCCCTGAATTGATCAAATGCTCTTTGAAGCGGGGCC
AGGCCTTCCAGGTGACCAACGGGGCGACCATCTGGAACAACGTCCATGTC
CAGGATCTTGCTAACCTCTACCTTCTCCTGACAGAAGCTGCTGCTCAGCC
TGACGGTGGAAAGGCTACTTGGGGGCCAGAAGGGTACTACTTTGCTGAGA
ACGGCGAGCACACGTGGGGCGAGCTCGCCAAGAAAATCGCCAAGAAAGCT
AAGGCTAAGGGCTACCTGAAGACAGACGAAGTTATCTCCTTGCCTAACGA
GGAAATTATCAAGCAACACCCCTTCGGCCACATCCTCTGGGGCACAAATT
CCCGCGGTTGGGCCTCGCGCGCTAGAAAGGTTCTCGGATGGGAGCCGAAG
GGCGCCCCCTTAGACGAAACCCTCGACG

Sequences in the Contig:

SY0AAA22YK17FM1 SY0AAA41YE08FM1 SY0AAA41YM24FM1
SY0AAB54YI16FM1 SY0AAB55YI16FM1 SY0AAC48YF10FM1
SY0AAC53YA09FM1 SY0AAD27YC15FM1 SY0AAD34YP10FM1