Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1072
Length(NT) : 562
Best Gene Model Blast : Link to GSTUMT00011373001 E-value : 0.0
Numbers of ESTs : 2

Blast Results:

Nr Definition: hypothetical protein SNOG_03186
Accession: ref|XP_001793765.1| Score: 572 E_value: 2e-57
KEGG Definition: ALLANTOICASE
Accession: ncr:NCU01816.1 Score: 550 E_value: 3e-55
KOG Definition:
Classification: [Nucleotide transport and metabolism].
Kog Number: KOG4145 Score: 532 E_value: 3e-55
PFAM Definition: Allantoicase, Allantoicase repeat. This family is found in pairs in Allantoicases, forming the majority of the protein. These proteins allow the use of purines as secondary nitrogen sources in nitrogen-limiting conditions through the reaction: allantoate + H(2)0 = (-)-ureidoglycolate + urea..
Pfam Number: pfam03561 Score: 514 E_value: 3e-53
Swissprot: P18407|ALLC_NEUCR

Sequence:
>Contig1072
TTGGCCAACTTGCAACAACTAGGTCTTCAAGAAATAAATACCATGTCTTC
CAACACAGCTCACCGCATTGACGAATCTGAAGCTCAAGAGGCTTTTATGT
CCTCCTGCATTGATCTCATTAGCTCCGCTCTTGGTGGCCAAGTCATCGAA
TTTAGTGACCAATGGTTTGCTGCTGCCGAGAACTTAATCAACCCAGCTCC
TCCGATTGGCAGACCCGGCGTGTTTGTACCTACGGGTGCTTGGTACGACG
GATGGGAGACGAGAAGACACAACAAAGCCCCTGCCGATTGGGTCATCATT
AAACTTGGAGTTGCCAGTGGTAGAGTCCATGGTTTCGAGGTCGACACAGC
TTTTTTCAAAGGAAACTATGCTCCGGCAGTCACCGTTGAGGGCACCTTCC
TTGATGGCAGCCACCCAGACACAAGCACGGTATGGGAAGAAATCCTCCCA
ATGCAGGAATGCGGCCCTTCTCAGAGACACATCTGGAAGCTTAGCTCTCC
CACTACCAAAGCTTATTCCCATGTCCGCCTCAATATGTTCCCGGACGGGG
GAATTGCCCGCT

Sequences in the Contig:

SY0AAA41YE02FM1 SY0AAA46YF06FM1