Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1071
Length(NT) : 924
Best Gene Model Blast : Link to GSTUMT00011022001 E-value : 0.0
Numbers of ESTs : 4

Blast Results:

Nr Definition: hypothetical protein FG05026.1
Accession: ref|XP_385202.1| Score: 460 E_value: 5e-44
KEGG Definition: hypothetical protein
Accession: fgr:FG05026.1 Score: 460 E_value: 2e-44
KOG Definition:
Classification: [General function prediction only].
Kog Number: KOG3246 Score: 324 E_value: 7e-31
PFAM Definition: No Hit Found
Swissprot: O13612|NEP2_SCHPO
Gene Ontology:
GO:0005737 = Cellular component: cytoplasm
GO:0005634 = Cellular component: nucleus
GO:0019784 = Molecular function: NEDD8-specific protease activity
GO:0000338 = Biological process: protein deneddylation
GO:0016925 = Biological process: protein sumoylation
GO:0006508 = Biological process: proteolysis

Sequence:
>Contig1071
TTGGCACCAACAGCCCTGTACTGAGTACTGTACAGTACTCCTACCAATTA
ACCCAACATTACCGTGCTCCCTCAATCACACCGCTAACAAACAATAATAA
CCCTCACTCTCAGTTCTCTGAAAACTACTGGAACCCAATCGACCACTACC
TTCTCCCCAACCAGCCTTGTTGCTGCGTATCCCGGCAGCAACACTCCCAG
CAGACTGTCTTCTTTCACTTTACACCTCACACACTCTCCCAACATCTATC
AACTCCCCAACCCTCTAACGAAAGAATGCCTTTCCGCGATGCAATCCGAG
AGATGAGCGGGTTCCATCGGGACGAGGTAACTACTTCCAATCCCCCCACC
ACTTCGTCGGCTCCAACCTCTTCTTCGTCTCCCCCTCCTCCGAGAAGTAG
TGGGGGCGGAAGGGGAATGATGGATCGGATGGCTGATGCTGGAGGAAATT
TACGACTTCGTCGGAATGAAATGAAGTTACGACCTGAGGACCCTTATCTT
AGCTATTACGATGTTTGCGTTACCAAAGAAGACATCGACTGTTTAAAGGG
AGACTGGTTGACAGACAATAATATCTCGTTCTGGGAGGAATATCTTGAAC
ATGAAGAGTTGAAAAGTCCTAACAATAAAGTTATGCTGTTGAGACCCTCA
ATGGTGTTCCTGCTAAAGAACACCAAAGATCCGCTTACGCTTGAGTCTGC
TCTACCGGATGTAAAAAAAGCCTCTCACATCTTCCTCCCCATTAACGACT
GCCGCAATCCTTCAATTCCTGAGGGTGGAACACATTGGTCCCTTCTCGTT
GTCGGAGTCAGCGACCGTGTAGCTTTCCACTATGATTCGCTCTCGCCTGC
AAATTGTGGCGAGGCTCGAGAGGTATGTAAGAAGCTGGGGGTTTTACTCG
GGTTTTCGCTCCAATTTTTCGATC

Sequences in the Contig:

SY0AAA41YD18FM1 SY0AAD25YA23FM1 SY0AAD39YF24FM1
SY0AAD40YF24FM1