Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1070
Length(NT) : 898
Best Gene Model Blast : Link to GSTUMT00011017001 E-value : 0.0
Numbers of ESTs : 6

Blast Results:

Nr Definition: hypothetical protein FG08956.1
Accession: ref|XP_389132.1| Score: 252 E_value: 6e-20
KEGG Definition: hypothetical protein
Accession: fgr:FG08956.1 Score: 252 E_value: 3e-20
KOG Definition:
Classification: [Cytoskeleton].
Kog Number: KOG1840 Score: 177 E_value: 7e-14
PFAM Definition: No Hit Found
Swissprot: P46824|KLC_DROME
Gene Ontology:
GO:0042802 = Molecular function: identical protein binding

Sequence:
>Contig1070
TTGGAATTAGGCCACGTACTATCGAGGCTAGGGGAATTGGACAAGGCGAT
GCAAATCGCAAACAGCGTACTAGAAGCGCAGCAGCGGAAGCCGGAGGGCG
TAGCGAACCGACACACCACCATATCAGCAAACAAGCTGCTCGGCACACTT
CTCGAGAAGAAAGGTTGCTACCAGCCCGCCAAGGCGATCCTAGAGGAAGT
CCTCGCCCTCCAGGAGGAGCTATTCGGAAAAGATCACCCAGAGACACTCT
CCGTCATGGACTGCCTGGGCACGACATACCTATCCCTTGGCGAGCCTGCG
AAGTCCGAAGAAATCCTCCGCCGCACTGTGGACCTCTCGACAGAAAAGCT
CGGGGGAAAGCACCCGGACACGCTCTCCTCCAAGCACAACCTTGTCAACG
CACTCCTCAAAAGTCGCGACTTTGCCGCGGCGAAGGACCTTGCGGGAACG
GTGTACGCCGAAACCCGCCAGGTGCTCGGCGATGAGCACGTGGATACCGC
GTTCTCTATGGTGAACCAGGCCTCCGCGCTCATGGGTATTGGAGACGTCG
CTGGTGCGGTAAATATCCTCCGGGCCACCGTGGCTAAATTGGCTGTCATC
CTTCCCGCTGGGAACTCCCATGTGCTTTTAGTAAAGGAGAAGCTTGCCCA
AGGATTAGTGGATTCGTTTAGGTTCCCCGAAGCAGAGAGGGTCATGCGCG
AGGTACTCGTCGAGAGGAGGTGTGCCCTCGGGGATGCACATCCCGAGACT
ATTCGTGTGGAGGAGTGGTTGGGCATGTGCCGGGCGAGGATGGGGGGGGC
AGAGGCGGTGGCGGGGAGTGGGGAGAGTGCTGCTACTGCCACTGCCGGTG
AATGGACCGGGAAAGGGGGGGTTTCTCGGGGGGGGTGTCGGAATGGTG

Sequences in the Contig:

SY0AAA39YP05FM1 SY0AAA41YD09FM1 SY0AAA41YK18FM1
SY0AAB23YN08FM1 SY0AAB36YD02FM1 SY0AAD2YL23FM1