Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1069
Length(NT) : 2855
Best Gene Model Blast : Link to GSTUMT00002955001 E-value : 0.0
Numbers of ESTs : 11

Blast Results:

Nr Definition: predicted protein
Accession: ref|XP_001543928.1| Score: 215 E_value: 5e-15
KEGG Definition: No Hit Found
KOG Definition:
Classification: [Translation, ribosomal structure and biogenesis].
Kog Number: KOG2072 Score: 149 E_value: 5e-10
PFAM Definition: TolA, TolA protein. This family consists of several bacterial TolA proteins as well as two eukaryotic proteins of unknown function. Tol proteins are involved in the translocation of group A colicins. Colicins are bacterial protein toxins, which are active against Escherichia coli and other related species (See pfam01024). TolA is anchored to the cytoplasmic membrane by a single membrane spanning segment near the N-terminus, leaving most of the protein exposed to the periplasm..
Pfam Number: pfam06519 Score: 157 E_value: 5e-11

Sequence:
>Contig1069
TTGGGGCGTAGAAGGACATCATCGAACGTTAGCGGTGGTAGCGGGAGCAC
TGGAAGGAGGCCGTCTTTTAGCAAATTTGGGCTTGAACAACCCCCAACCC
CCGAAGATGGGAGATTTCCCTTAAGGCCTAGCCCCATAAGCCATTTCTCG
ACAGATGCACATCAAGATCATAACCAAACTAGCTTGCCCGCCAAATTCGA
GAATTCTAACCAAGCTTCTAACATTGAAGTCCCTTCTCTGGCAGCCGTTC
CAATTAAGCCAGCCATACCAGAGACTCCCATGGAAGATCTAGTTGCTCAG
CAGGAACGGATTATGAAGGAAGGTCGTGAACTCGCGAGGAAGCGCAGACA
GGAAGAGGAAGAAAAGGAAGAAGCCGCTAAGAAAGAGAGACTTCAGGTTA
AACTAGATGAATTAGAGAAAAAGGCTCTTGAGAAGAAAGAAGCTGAGTTA
CGAGCGGCAGAAGAGGCGAGATTGGCTGAGGAAAAGGCTGAGGCTGATAG
AAAGGCTGAGGAAGAGAGAGTCAATGCGGAGAAAAAGGCTGCAGAGGAAG
AAGCAGCTCGTAAGGCTGCCGAAGCCAGACCCGTATCGGACCGATATGAG
CATCCTCGTAGCTATCTTCCTACTCAACCTCAAAGTCGGCGCTCTTTGAA
TACCATGCAAAATCGGTCTCCAAACAGGAGCTTTGCAATACCCGCCATAA
GGGATTCTAAGGATCAACCATGGAAACACGTGTCTCCGGGCAATGACAGG
TATACCAGTTGGGGCGGTGCGCAACAGAATAGCCAGGGCTCTGGTCCCAA
TCCTTGGGGACCTATCGAAAAACCCAAGTTTCAAGGCATGAATGGTGTTG
GAAACGGGACGTTCGATAACGGATATTCTGGGTTTTCGACAAGACCACCG
CCGCCTACGTCTGCTTATCCACAGAATCCCAGGGATGATAGGCGTAATAG
CAGAGGCCCACCGACCTCCCCGGGACTCTCCCGTGGTGGATTATCTCAGT
ATGACAGGGCTCAAGCTGTTAGCCGTTGGAACGCTCTACCCGGCAAAATC
CTGGAGGATGAAGCTGAGCAACGGAGAAAAGATCGAGAAGCCTACCTCGC
CAGACAAGCAGAGGAAGCAGCCACTGGCGTAAAAAAACCAGGTATAGTTC
CACCGAAGCTGGTTGAGACATGGAGAAAGACAAATGGAGATGAACCCGAA
TCCAAATTCGTTGTTAAAACCGAAACCTCTCAGGAGGGAGAGCAATCGAG
CTCCGCTGAGAAACTGCCTGGAGGGCTGTTGGCTACAACTATAGGCACTA
GCATGGAAGACACCAGGGTAGAATCTAGTCATCCCACGGGTCCTGCTCCC
AACGTCCCGACTGGGCCAGCAGCGACTCGGCCTGCCTCTCGATTCTTCCC
GGCAGCGGCTGGCAATCTCATTGCCCAACATTTGGGAACTCAATCTAAAT
CCTCTCACTCTCCTGCCAAGGCGCTTAGTCCACCAGGCTCCCCGCCACCT
CCAATGTCCGCTGAGCACCCAGTTCATGGGGATATAAATTCCCGGGTTGT
GCAACTACCCCCTTCTGGTCACGGGCATTATCAACATCCGCACGGAAGGG
TATCACCCACCCTGCACATGAATGGATATCATAGGACGAATCATCCCAAA
TCACCACAATTTTCGGGGGTCCAGGCTTTTGAGGCCGTGCAGCAGAAGAT
TCTGGGCATGACCCAGAAACATTCACCCCCCCAGCAGACAGCAAACCTCC
AAGCTCAACCACCAAAGGGGCCCGCATCAAGGGATTTCTCGACAACTAAA
CCCCTATACGATGGATCCCCGGAGAGAGTTGTTTCGAGGCCTGCGACGGT
CTCGCTTCCACCCCAGTCAGATGGTGAAGAGGGTAGTAGTAATTGCCATG
ATGTCTATGAGGAATCCATTCTCACCAAGCCGGATAACGAGGAATTTTTC
CACGAGCTTTTTGAGCGTGACTTTGGCTCTACACCTACAGTTAAACTCCC
TCATATCGTCCCCGCTATTTATGCGAATCATTCGAAGAAAATTCCGGCCG
CCAACTTGCCAAAGCCTTACAGTAAGCGGCCTCCCTCGAAATGGCAGCTT
CAGACCACCGACATATTCAATCCATTCGGGCAAAAGGATTTCATCAACGG
GGAGGGTAAAAGGTTTATTCCTGTTCACCTCCCTGGAGGCGCATCCATCG
AAGTGTTGAGCCGTGATGGGAGGCGTAGCACAGGCAATAAGAAGGGATAT
TCTCAACAGAGATCAAAGAACAGCCGTTATAACGGAGGGGGGAATACTGG
TGGCGGCCATATCGGGCGTGGTGGGGTGGGTAGGAGGGTCGCAGATCCGG
TTCAGTAACGTAACTGAAGAGCATTCGAGGGTGGTCATGGCTGTTTAATG
TTTTGTCCTGTTTGCTTTATCCGCTGCTCGGTGTGCGTGAGGGCTCGTGG
TGTTGCTGATAGATGATGAATGTCTTGTCTGAATACGAAGCAATGGTGAC
CAAGGTGGGAAGTGTGCGTATCAGCTCCCGGTTTGGCCATCATAAGATAG
CTCGAATATTGTAGATTAGCTGGACATGGGAGTCTCTTGTTTTGTCTTTT
CTTCTTCGCATTCCTTGTACCCATCACACAGGACGTCTTTCCCTGGTTCT
TTTCCTGTTTGGTTAAGTTGTAGCCAAGGTTTTTTCTTTCTCTCTTTTTT
TTTTTTCTTCCATATCTCTTAAGCTTCTTCCTTATTCCAGTTTCTCTCCA
CTATTCATATTCTGTTTTCTGCTTAGCTTGGCGTCTGTAGGGTTTCGGTA
TGCTGTGCTGTGCTGTGCTGTGCGTGAAACTCCTCTCTCTCTCAAGTTCC
TGTTG

Sequences in the Contig:

SY0AAA30YP04FM1 SY0AAA41YC11FM1 SY0AAB28YA17FM1
SY0AAB49YL04FM1 SY0AAC2YH07FM1 SY0AAC62YF14FM1
SY0AAD14YO21FM1 SY0AAD35YA11FM1 SY0AAD49YE12FM1
SY0AAD50YE24FM1 SY0AAD60YE19FM1